WormBase Tree Display for Variation: WBVar00249497

WBVar00249497 Name: Public_name: tm451
    HGVSg: CHROMOSOME_II:g.10143144_10144239delinsCAGCA
  Sequence_details: SMap: S_parent: Sequence: F27E5
    Flanking_sequences: ccagagttttgcaaatgttgagcagcacag tatatttcctaatccgcagcaatctgccac
    Mapping_target: F27E5
    Source_location: 7 CHROMOSOME_II 10143143 10144240 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CAGCA
      Deletion
    PCR_product: tm451_external
      tm451_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 451
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009193
    Transcript: F27E5.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-446
        CDS_position: ?-446
        Protein_position: ?-149
        Intron_number: 1-3/8
        Exon_number: 1-4/9
    Interactor: WBInteraction000052370
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. M.M.Barr: complement n4132 mutant. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000306 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Dr. M.M.Barr: WT pkd-2::gfp expression. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 21744/21745-CAGCA-22840/22841 (1096 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele