WormBase Tree Display for Variation: WBVar00249531
expand all nodes | collapse all nodes | view schema
WBVar00249531 | Name | Public_name | tm488 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C33B4.3a.1:c.331-86_1608del | |||||||
C33B4.3c.1:c.331-86_1608del | ||||||||
C33B4.3b.1:c.331-86_1608del | ||||||||
HGVSg | CHROMOSOME_II:g.11388638_11390174del | |||||||
Sequence_details | SMap | S_parent | Sequence | C33B4 | ||||
Flanking_sequences | acctgttggcggtcgatgcacaatagttcc | tgcatctgatggaatatgacgcataaaaca | ||||||
Mapping_target | C33B4 | |||||||
Source_location | 7 | CHROMOSOME_II | 11388637 | 11390175 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm488_external | |||||||
tm488_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 488 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006444 | ||||||
Transcript | C33B4.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C33B4.3b.1:c.331-86_1608del | |||||||
cDNA_position | ?-1789 | |||||||
CDS_position | ?-1608 | |||||||
Protein_position | ?-536 | |||||||
Intron_number | 3-6/11 | |||||||
Exon_number | 4-7/12 | |||||||
C33B4.3c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C33B4.3c.1:c.331-86_1608del | |||||||
cDNA_position | ?-1688 | |||||||
CDS_position | ?-1608 | |||||||
Protein_position | ?-536 | |||||||
Intron_number | 3-6/13 | |||||||
Exon_number | 4-7/14 | |||||||
C33B4.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C33B4.3a.1:c.331-86_1608del | |||||||
cDNA_position | ?-1686 | |||||||
CDS_position | ?-1608 | |||||||
Protein_position | ?-536 | |||||||
Intron_number | 3-6/12 | |||||||
Exon_number | 4-7/13 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000306 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Rongo to the National Bioresource Project of Japan: normal GLR-1::GFP expression. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | OR | |||||||
Remark | 23167/23168-24704/24705 (1537 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |