WormBase Tree Display for Variation: WBVar00249566

WBVar00249566 Name: Public_name: tm526
    HGVSg
  Sequence_details: SMap: S_parent: Sequence: F46E10
    Flanking_sequences: aatcactgttactgaaatataaaattttaa agaaaatccgaacgttcctcaattccaacc
    Mapping_target: F46E10
    Source_location: 7 CHROMOSOME_V 6509911 6510389 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GAAAATCCGAACGTTNNNATTAAAATCCGAA
      Deletion
    PCR_product: tm526_external
      tm526_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 526
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006721
    Transcript: F46E10.8.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,stop_retained_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: 405-790
        CDS_position: 384-?
        Protein_position: 128-?
        Intron_number: 6-7/8
        Exon_number: 6-9/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000031 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Inoue: Gro. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000154 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Inoue: reduced brood size Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000208 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Inoue: long defecation cycle Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 1906/1907-GAAAATCCGAACGTTNNNATTAAAATCCGAA-2383/2384 (477 bp deletion + 31 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele