WormBase Tree Display for Variation: WBVar00249583

WBVar00249583 Name: Public_name: tm544
    Other_name: C06A1.1.1:c.198+126_713del
    HGVSg: CHROMOSOME_II:g.10562400_10563067del
  Sequence_details: SMap: S_parent: Sequence: C06A1
    Flanking_sequences: agaattccacgtggtggcttgataccaata aaaccatcagcaaataaacagtactagctt
    Mapping_target: C06A1
    Source_location: 7 CHROMOSOME_II 10562399 10563068 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm544_external
      tm544_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00007563
    Component_of_genotype: WBGenotype00000081
      WBGenotype00000082
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 544
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00045152
      WBGene00007352
    Transcript: C06A1.1.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C06A1.1.1:c.198+126_713del
        cDNA_position: ?-730
        CDS_position: ?-713
        Protein_position: ?-238
        Intron_number: 2/6
        Exon_number: 3/7
      C06A1.9 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
    Interactor: WBInteraction000518653
      WBInteraction000520564
      WBInteraction000547571
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
    Mapping_data: In_multi_point: 5092
  Description: Phenotype: WBPhenotype:0001719 Paper_evidence: WBPaper00038083
        Curator_confirmed: WBPerson712
        Remark: UbV-GFP remains stabilized unlike in control animals where the GFP signal is downregulated. Paper_evidence: WBPaper00038083
            Curator_confirmed: WBPerson712
      WBPhenotype:0001724 Paper_evidence: WBPaper00031857
        Curator_confirmed: WBPerson712
        Remark: Mutants were more sensitive to Tunicamycin than N2 worms. At 5-ug/ml concentration of TM, 70% of cdc-48.1mutants failed to develop into adults Paper_evidence: WBPaper00031857
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: 0-10 ug/ml tunicamycin Paper_evidence: WBPaper00031857
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0001236 Paper_evidence: WBPaper00030999
        Curator_confirmed: WBPerson2987
        Remark: "Although either cdc-48.1(tm544) or cdc-48.2(tm659) did not induce the hsp-4::gfp expression (Fig. 1B), the hsp-4::gfp expression was clearly induced especially in intestine when both p97 were depleted simultaneously (Fig. 1C,D; Supplementary Fig. S1), implying that their simultaneous depletion induces UPR." Paper_evidence: WBPaper00030999
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: hsp-4::gfp Paper_evidence: WBPaper00030999
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001429 Paper_evidence: WBPaper00030999
        Curator_confirmed: WBPerson2987
        Remark: "As shown in Fig. 1A, dark staining large intestinal granules were observed in p97-depleted worms, while such granules were not observed in control worms. Note that single deletion mutant, either cdc-48.1(tm544) or cdc-48.2(tm659), did not cause such granules (data not shown)." Paper_evidence: WBPaper00030999
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0005772 PATO:0000460 Paper_evidence: WBPaper00030999
                Curator_confirmed: WBPerson2987
  Disease_info: Models_disease: DOID:332
    Models_disease_in_annotation: WBDOannot00001037
  Reference: WBPaper00038083
    WBPaper00031857
    WBPaper00030999
  Remark: 3193/3194-3861/3862 (668 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele