WormBase Tree Display for Variation: WBVar00249587
expand all nodes | collapse all nodes | view schema
WBVar00249587 | Name | Public_name | tm548 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F25D7.3a.1:c.713_1142-130del | ||||||||
F25D7.3b.1:c.713_1142-130del | |||||||||
HGVSg | CHROMOSOME_I:g.10410665_10411474del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F25D7 | |||||
Flanking_sequences | aaaagattgaagcaaatactgaattatcat | tcaacggaaaagttttcaaaatacatgttg | |||||||
Mapping_target | F25D7 | ||||||||
Source_location | 7 | CHROMOSOME_I | 10410664 | 10411475 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm548_external | ||||||||
tm548_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00047070 | ||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 548 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003847 | |||||||
Transcript | F25D7.3b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F25D7.3b.1:c.713_1142-130del | ||||||||
cDNA_position | 770-? | ||||||||
CDS_position | 713-? | ||||||||
Protein_position | 238-? | ||||||||
Intron_number | 4/8 | ||||||||
Exon_number | 4/9 | ||||||||
F25D7.3a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F25D7.3a.1:c.713_1142-130del | ||||||||
cDNA_position | 770-? | ||||||||
CDS_position | 713-? | ||||||||
Protein_position | 238-? | ||||||||
Intron_number | 4/9 | ||||||||
Exon_number | 4/10 | ||||||||
Interactor | WBInteraction000521439 | ||||||||
WBInteraction000532923 | |||||||||
WBInteraction000541114 | |||||||||
WBInteraction000541115 | |||||||||
WBInteraction000541120 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | I | |||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. W. Vermeulen: Gro | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00045431 | |||||||
Curator_confirmed | WBPerson703 | ||||||||
Remark | Partial penetrance | Paper_evidence | WBPaper00045431 | ||||||
Curator_confirmed | WBPerson703 | ||||||||
WBPhenotype:0000183 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. M. Hengartner: very slight increase in germ cell apoptosis. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | WS | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006796 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000229 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the NBP from Dr. K. Ashrafi: has a small body size; Dr. J. Kaplan: Sma. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | KQ | ||||||||
KP | |||||||||
WBPhenotype:0000583 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the NBP from Dr. R. Plasterk: Dpy appearance; Dr. W. Vermeulen: Dpy; Dr. Y-C. Wu: mild Dpy | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | NL | ||||||||
YW | |||||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. Y-C. Wu: slightly Unc | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | YW | ||||||||
WBPhenotype:0000697 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. W. Vermeulen: Pvl. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001182 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. K. Ashrafi to the National Bioresource Project of Japan: has altered fat content at adult stage. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | KQ | ||||||||
WBPhenotype:0001355 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the NBP from Dr. Y-C. Wu: abnormal gonad morphology; Dr. J. Kaplan: abnormal gonad. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | YW | ||||||||
KP | |||||||||
WBPhenotype:0001494 | Paper_evidence | WBPaper00045431 | |||||||
Curator_confirmed | WBPerson703 | ||||||||
Phenotype_not_observed | WBPhenotype:0000032 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. K. Ashrafi to the National Bioresource Project of Japan: healthy. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | KQ | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. R.H. Horvitz: not synMuv with class A or B mutations and not a synMuv suppressor. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
MT | |||||||||
WBPhenotype:0000679 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. O. Blacque: wild-type localization of ODR-10 to AWB cilium. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | OEB | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. K. Ashrafi to the National Bioresource Project of Japan: fertile. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | KQ | ||||||||
WBPhenotype:0000729 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. C. Yang: no obvious cell death defects | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FU | ||||||||
WBPhenotype:0002535 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. O. Blacque: Dyf (+) | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | OEB | ||||||||
Reference | WBPaper00045431 | ||||||||
Remark | 19893/19894-20703/20704 (810 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |