WormBase Tree Display for Variation: WBVar00249596

WBVar00249596 Name: Public_name: tm557
    Other_name: CE00981:p.Val19GlnfsTer106
      F35H8.3.1:c.54_183del
    HGVSg: CHROMOSOME_II:g.9557797_9558029del
  Sequence_details: SMap: S_parent: Sequence: F35H8
    Flanking_sequences: cccttctgcaatggttatatacgaagaaga acaatccaaagggaacaactatccacgagt
    Mapping_target: F35H8
    Source_location: 7 CHROMOSOME_II 9557796 9558030 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm557_external
      tm557_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 557
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009448
    Transcript: F35H8.3.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as 'homozygous viable' by the National Bioresource Project of Japan. Comments to the National Bioresource Project of Japan: Dr. S. van den Heuvel: BMC Dev. Biol. 7, 30 (2007). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000228 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. R. Plasterk to the National Bioresource Project of Japan: no mutator phenotype. Comment from Dr. S. van den Heuvel to the National Bioresource Project of Japan: BMC Dev. Biol. 7, 30 (2007). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: NL
      WBPhenotype:0000743 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. R. Plasterk to the National Bioresource Project of Japan: not deficient in RNAi. Comment from Dr. S. van den Heuvel to the National Bioresource Project of Japan: BMC Dev. Biol. 7, 30 (2007). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: NL
  Remark: 7543/7544-7776/7777 (233 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele