WormBase Tree Display for Variation: WBVar00249714
expand all nodes | collapse all nodes | view schema
WBVar00249714 | Name | Public_name | tm684 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_X:g.1105589_1106379del | |||||||
Sequence_details | SMap | S_parent | Sequence | C05D9 | ||||
Flanking_sequences | aaaaaacaactgaaaacatttcacaccata | cagtcgtttggtaatcatcatgaaaaatgg | ||||||
Mapping_target | C05D9 | |||||||
Source_location | 7 | CHROMOSOME_X | 1105588 | 1106380 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm684_external | |||||||
tm684_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 684 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002062 | ||||||
Transcript | C05D9.5.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 4/5 | |||||||
Exon_number | 5-6/6 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000007 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: Egl at 25C, frequent bagging. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 25 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000640 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: Egl at 25C | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 25 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000673 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: less progeny at 25C. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 25 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000531 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal development. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000535 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal body size/shape. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark (2) | ||||||||
Method | NBP_knockout_allele |