WormBase Tree Display for Variation: WBVar00249806

WBVar00249806 Name: Public_name: tm778
    Other_name: C24G7.4.1:c.555_1051-19del
    HGVSg: CHROMOSOME_I:g.4095894_4096623del
  Sequence_details: SMap: S_parent: Sequence: C24G7
    Flanking_sequences: ggaaacattggaatatcttttacaaacaaa aactgaaaatattttcagcacaatctccta
    Mapping_target: C24G7
    Source_location: 7 CHROMOSOME_I 4095893 4096624 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm778_external
      tm778_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 778
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016066
    Transcript: C24G7.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C24G7.4.1:c.555_1051-19del
        cDNA_position: 574-?
        CDS_position: 555-?
        Protein_position: 185-?
        Intron_number: 4-6/9
        Exon_number: 4-6/10
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype_not_observed (5)
  Remark: 30194/30195-30924/30925 (730 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele