WormBase Tree Display for Variation: WBVar00249846

WBVar00249846 Name: Public_name: tm819
    Other_name: CE48050:p.Lys345AspfsTer31
      C52E12.2a.2:c.1032_1816delinsCGATAGAGC
      C52E12.2b.1:c.1032_1816delinsCGATAGAGC
      C52E12.2a.1:c.1032_1816delinsCGATAGAGC
      CE47855:p.Lys345AspfsTer31
    HGVSg: CHROMOSOME_II:g.7002529_7003787delinsCGATAGAGC
  Sequence_details: SMap: S_parent: Sequence: C52E12
    Flanking_sequences: accaaaatcttttagatatgccgatagagc agaaaatgttagaaatggaatctcaataca
    Mapping_target: C52E12
    Source_location: 7 CHROMOSOME_II 7002528 7003788 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CGATAGAGC
      Deletion
    PCR_product: tm819_external
      tm819_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 819
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006831
      WBGene00196158
      WBGene00022966
      WBGene00022967
    Transcript: C52E12.2a.2 (11)
      C52E12.2b.1 (11)
      C52E12.t2 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      C52E12.t3 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      C52E12.2a.1 (11)
      C52E12.8 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment from Dr. E. Jorgensen: Sub-viable on OP50 but can be maintained on HB101. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
              EG
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000241 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. Z. Zhou: no persistent cell corpses. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: ZH
  Remark: 9466/9467-CGATAGAGC-10725/10726 (1259 bp deletion + 9 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele