WormBase Tree Display for Variation: WBVar00249960

WBVar00249960 Name: Public_name: tm938
    Other_name: Y39H10A.7a.1:c.699-74_932del
      Y39H10A.7b.1:c.423-74_656del
    HGVSg: CHROMOSOME_V:g.3758270_3758577del
  Sequence_details: SMap: S_parent: Sequence: Y39H10A
    Flanking_sequences: gatatggccgaagccatctattaaactcac gtttttattgttttttctcgtttatacaca
    Mapping_target: Y39H10A
    Source_location: 7 CHROMOSOME_V 3758269 3758578 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm938_external
      tm938_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 938
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000498
    Transcript: Y39H10A.7a.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y39H10A.7a.1:c.699-74_932del
        cDNA_position: ?-938
        CDS_position: ?-932
        Protein_position: ?-311
        Intron_number: 3/6
        Exon_number: 4/7
      Y39H10A.7b.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y39H10A.7b.1:c.423-74_656del
        cDNA_position: ?-656
        CDS_position: ?-656
        Protein_position: ?-219
        Intron_number: 2/4
        Exon_number: 3/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. M. Hengartner: Cell Death Differ 14; 1129 (2007). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000116 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: 1) Dr. H. Sawa: homozygous lethal at L2-L3 stage and Unc. 2) Dr. H-S. Koo: as above. 3) Dr. S. Boulton: lethal at L2-L3. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000027 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
            WBls:0000035 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: 1) Dr. H. Sawa: Unc. 2) Dr. H-S. Koo: as above. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 25948/25949-26256/26257 (308 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele