WormBase Tree Display for Variation: WBVar00250003

WBVar00250003 Name: Public_name: tm981
    Other_name: C24G7.2.1:c.490_729-225del
    HGVSg: CHROMOSOME_I:g.4105030_4105594del
  Sequence_details: SMap: S_parent: Sequence: C24G7
    Flanking_sequences: tgcaatttaaatccaattcggaaaacttat cgcaagatttatattcatttacaatagata
    Mapping_target: C24G7
    Source_location: 7 CHROMOSOME_I 4105029 4105595 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm981_external
      tm981_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 981
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016064
    Transcript: C24G7.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C24G7.2.1:c.490_729-225del
        cDNA_position: 505-?
        CDS_position: 490-?
        Protein_position: 164-?
        Intron_number: 6-7/15
        Exon_number: 6-7/16
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000072 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal body size/shape. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000525 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. Y. Jin to the National Bioresource Project of Japan: normal behavior. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000531 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal development. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. N. Tavernarakis: normal locomotion; Dr. S. McIntire: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000673 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal brood size. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 39330/39331-39895/39896 (565 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele