WormBase Tree Display for Variation: WBVar00250120
expand all nodes | collapse all nodes | view schema
WBVar00250120 | Name | Public_name | tm1103 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F55B12.1.1:c.375_481delinsATGTACGTT | ||||||||
CE25006:p.Leu126CysfsTer27 | |||||||||
HGVSg | CHROMOSOME_V:g.13814221_13814711delinsATGTACGTT | ||||||||
Sequence_details | SMap | S_parent | Sequence | F55B12 | |||||
Flanking_sequences | gaatgatccaagatttgcagcagctgcagc | aagtttacgaattggaacgaagattcaaac | |||||||
Mapping_target | F55B12 | ||||||||
Source_location | 7 | CHROMOSOME_V | 13814220 | 13814712 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | ATGTACGTT | |||||||
Deletion | |||||||||
PCR_product | tm1103_external | ||||||||
tm1103_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00008317 | ||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1103 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000447 | |||||||
Transcript | F55B12.1.1 (11) | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | V | |||||||
Description | Phenotype | WBPhenotype:0000572 | Paper_evidence | WBPaper00050847 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
Remark | "In ceh-24 mutant worms, expression from the ceh-24 promoter was increased. Processes did not run straight along the muscle but diverted from it or branched. Processes also ended prematurely and did not extend as far posteriorly as in the wild type (Figure 3B)" | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005361 | PATO:0000460 | Paper_evidence | WBPaper00050847 | ||||
Curator_confirmed | WBPerson38423 | ||||||||
WBbt:0005359 | PATO:0000460 | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
WBbt:0005353 | PATO:0000460 | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Phenotype_assay | Strain | WBStrain00008317 | Paper_evidence | WBPaper00050847 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Genotype | goeIs247[pceh-24::GCaMP6s::mKate2-unc-54-3'utr, unc-119(-)] | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
WBPhenotype:0000795 | Paper_evidence | WBPaper00050847 | |||||||
Curator_confirmed | WBPerson38423 | ||||||||
Remark | reduced flipping behavior | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Phenotype_assay | Strain | WBStrain00008317 | Paper_evidence | WBPaper00050847 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
WBPhenotype:0002367 | Paper_evidence | WBPaper00050847 | |||||||
Curator_confirmed | WBPerson38423 | ||||||||
Remark | "ceh-24 mutant worms could also eventually escape from the indentation, but needed four times longer for this (Figure 2E)" | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Phenotype_assay | Strain | WBStrain00008317 | Paper_evidence | WBPaper00050847 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Phenotype_not_observed | WBPhenotype:0000077 | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Remark | There is no contribution of flipping to the molting process. | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Phenotype_assay | Strain | WBStrain00008317 | Paper_evidence | WBPaper00050847 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00050847 | |||||||
Curator_confirmed | WBPerson38423 | ||||||||
Remark | "ceh-24(-) responded normally to mechanical stimulation (Figure 2 - figure supplement 2C)" | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Phenotype_assay | Strain | WBStrain00008317 | Paper_evidence | WBPaper00050847 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00050847 | |||||||
Curator_confirmed | WBPerson38423 | ||||||||
Remark | "locomotion quiescence during sleep appeared normal"; "Despite the absence of flipping, the time the animals took from resuming pumping until complete shedding of the old cuticle was not significantly altered in ceh-24 mutant animals and we could not detect any obvious defects in the new cuticle (Figure 2D)" | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Phenotype_assay | Strain | WBStrain00008317 | Paper_evidence | WBPaper00050847 | |||||
Curator_confirmed | WBPerson38423 | ||||||||
Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050847 | ||||||
Curator_confirmed | WBPerson38423 | ||||||||
Reference | WBPaper00050847 | ||||||||
Remark | 4519/4520-ATGTACGTT-5010/5011 (490 bp deletion + 8 bp insertion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |