WormBase Tree Display for Variation: WBVar00250123
expand all nodes | collapse all nodes | view schema
WBVar00250123 | Name | Public_name | tm1106 | ||||
---|---|---|---|---|---|---|---|
Other_name | C45E1.1a.2:c.553_861+65del | ||||||
C45E1.1b.1:c.478_786+65del | |||||||
C45E1.1a.1:c.553_861+65del | |||||||
C45E1.1c.1:c.571_879+65del | |||||||
HGVSg | CHROMOSOME_I:g.3107991_3108788del | ||||||
Sequence_details | SMap | S_parent | Sequence | C45E1 | |||
Flanking_sequences | GTTTTGGAAGGATTTCAGAGAGTTGATAAT | GAAATAATATTGATCATAAGTTTCATGTCA | |||||
Mapping_target | C45E1 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | tm1106_external | ||||||
tm1106_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | FX | ||||||
Author | Mitani S | ||||||
DB_info | Database | National_Bioresource_Project | seq | 1106 | |||
NBP_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00003654 | |||||
Transcript | C45E1.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | C45E1.1b.1:c.478_786+65del | ||||||
cDNA_position | 478-? | ||||||
CDS_position | 478-? | ||||||
Protein_position | 160-? | ||||||
Intron_number | 3-6/6 | ||||||
Exon_number | 3-6/7 | ||||||
C45E1.1c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C45E1.1c.1:c.571_879+65del | ||||||
cDNA_position | 571-? | ||||||
CDS_position | 571-? | ||||||
Protein_position | 191-? | ||||||
Intron_number | 5-8/8 | ||||||
Exon_number | 5-8/9 | ||||||
C45E1.1a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C45E1.1a.2:c.553_861+65del | ||||||
cDNA_position | 703-? | ||||||
CDS_position | 553-? | ||||||
Protein_position | 185-? | ||||||
Intron_number | 6-9/10 | ||||||
Exon_number | 6-9/11 | ||||||
C45E1.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C45E1.1a.1:c.553_861+65del | ||||||
cDNA_position | 558-? | ||||||
CDS_position | 553-? | ||||||
Protein_position | 185-? | ||||||
Intron_number | 5-8/9 | ||||||
Exon_number | 5-8/10 | ||||||
Isolation | Mutagen | TMP/UV | |||||
Genetics | Map | I | |||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||
Curator_confirmed | WBPerson48 | ||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson48 | ||||||
Laboratory_evidence | FX | ||||||
WBPhenotype:0000306 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | ||||||
Remark | Comment from Dr. M. Barr to the National Bioresource Project of Japan: PKD-2::GFP expression=WT. | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson48 | ||||||
Remark | 12992/12993-13790/13791 (798 bp deletion) | ||||||
This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 | Paper_evidence | WBPaper00041807 | |||||
Method | NBP_knockout_allele |