WormBase Tree Display for Variation: WBVar00250125
expand all nodes | collapse all nodes | view schema
WBVar00250125 | Name | Public_name | tm1108 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T12E12.4a.2:c.576_954delinsCTCCAGCGAACCAGGATT | |||||||
T12E12.4b.2:c.576_954delinsCTCCAGCGAACCAGGATT | ||||||||
CE30173:p.Phe193SerfsTer27 | ||||||||
CE30172:p.Phe193SerfsTer27 | ||||||||
T12E12.4a.1:c.576_954delinsCTCCAGCGAACCAGGATT | ||||||||
T12E12.4b.1:c.576_954delinsCTCCAGCGAACCAGGATT | ||||||||
HGVSg | CHROMOSOME_IV:g.5539115_5539538delinsCTCCAGCGAACCAGGATT | |||||||
Sequence_details | SMap | S_parent | Sequence | T12E12 | ||||
Flanking_sequences | cattctggctgtaactccagcgaaccagga | tcggatcttgttgcattcggtgaaccagtt | ||||||
Mapping_target | T12E12 | |||||||
Source_location | 7 | CHROMOSOME_IV | 5539114 | 5539539 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | CTCCAGCGAACCAGGATT | ||||||
Deletion | ||||||||
PCR_product | tm1108_external | |||||||
tm1108_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00005196 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1108 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001093 | ||||||
Transcript | T12E12.4b.2 (11) | |||||||
T12E12.4a.1 (11) | ||||||||
T12E12.4b.1 (11) | ||||||||
T12E12.4a.2 (11) | ||||||||
Interactor | WBInteraction000501344 | |||||||
WBInteraction000548956 | ||||||||
WBInteraction000571769 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description (2) | ||||||||
Disease_info | Models_disease | DOID:14330 | ||||||
Models_disease_in_annotation | WBDOannot00000741 | |||||||
Reference | WBPaper00038057 | |||||||
WBPaper00041209 | ||||||||
WBPaper00033026 | ||||||||
WBPaper00035144 | ||||||||
WBPaper00044205 | ||||||||
WBPaper00047030 | ||||||||
WBPaper00056369 | ||||||||
WBPaper00064979 | ||||||||
WBPaper00065803 | ||||||||
Remark | 1053/1054-CTCCAGCGAACCAGGATT-1477/1478 (425 bp deletion + 18 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |