WormBase Tree Display for Variation: WBVar00250125
expand all nodes | collapse all nodes | view schema
WBVar00250125 | Name | Public_name | tm1108 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | T12E12.4a.2:c.576_954delinsCTCCAGCGAACCAGGATT | ||||||||
T12E12.4b.2:c.576_954delinsCTCCAGCGAACCAGGATT | |||||||||
CE30173:p.Phe193SerfsTer27 | |||||||||
CE30172:p.Phe193SerfsTer27 | |||||||||
T12E12.4a.1:c.576_954delinsCTCCAGCGAACCAGGATT | |||||||||
T12E12.4b.1:c.576_954delinsCTCCAGCGAACCAGGATT | |||||||||
HGVSg | CHROMOSOME_IV:g.5539115_5539538delinsCTCCAGCGAACCAGGATT | ||||||||
Sequence_details | SMap | S_parent | Sequence | T12E12 | |||||
Flanking_sequences | cattctggctgtaactccagcgaaccagga | tcggatcttgttgcattcggtgaaccagtt | |||||||
Mapping_target | T12E12 | ||||||||
Source_location | 7 | CHROMOSOME_IV | 5539114 | 5539539 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | CTCCAGCGAACCAGGATT | |||||||
Deletion | |||||||||
PCR_product (2) | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005196 | ||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1108 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001093 | |||||||
Transcript | T12E12.4b.2 (11) | ||||||||
T12E12.4a.1 (11) | |||||||||
T12E12.4b.1 (11) | |||||||||
T12E12.4a.2 (11) | |||||||||
Interactor | WBInteraction000501344 | ||||||||
WBInteraction000548956 | |||||||||
WBInteraction000571769 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | IV | |||||||
Description | Phenotype (16) | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. D. Xue to the National Bioresource Project of Japan: slow growth but not lethal or sterile. Originally classified as lethal OR sterile by the National Bioresource Project of Japan. Mol Cell, 31, 586 (2008). | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000140 | Paper_evidence | WBPaper00041209 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | did not significantly exacerbate L3 arrest at any time point | Paper_evidence | WBPaper00041209 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003513 | Paper_evidence | WBPaper00041209 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00041209 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | serial ultraviolet C radiation(UVC) exposure (10 J/m2) | Paper_evidence | WBPaper00041209 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. A. van der Bliek to the National Bioresource Project of Japan: Normal locomotion. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001983 | Paper_evidence | WBPaper00056369 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
Disease_info | Models_disease | DOID:14330 | |||||||
Models_disease_in_annotation | WBDOannot00000741 | ||||||||
Reference | WBPaper00038057 | ||||||||
WBPaper00041209 | |||||||||
WBPaper00033026 | |||||||||
WBPaper00035144 | |||||||||
WBPaper00044205 | |||||||||
WBPaper00047030 | |||||||||
WBPaper00056369 | |||||||||
WBPaper00064979 | |||||||||
WBPaper00065803 | |||||||||
Remark | 1053/1054-CTCCAGCGAACCAGGATT-1477/1478 (425 bp deletion + 18 bp insertion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |