WormBase Tree Display for Variation: WBVar00250177

WBVar00250177 Name: Public_name: tm1165
    Other_name: ZK180.1.1:c.1407-19_1751del
    HGVSg: CHROMOSOME_IV:g.4498345_4498708del
  Sequence_details: SMap: S_parent: Sequence: ZK180
    Flanking_sequences: aatatacttacaatgtgaggaagttcagtg tttttgaagaagaagaaatattttgaagat
    Mapping_target: ZK180
    Source_location: 7 CHROMOSOME_IV 4498344 4498709 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1165_external
      tm1165_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00055690
      WBStrain00055694
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1165
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022675
    Transcript: ZK180.1.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: ZK180.1.1:c.1407-19_1751del
        cDNA_position: ?-1890
        CDS_position: ?-1751
        Protein_position: ?-584
        Intron_number: 11/20
        Exon_number: 12/21
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description (2)
  Reference: WBPaper00032008
  Remark: 9048/9049-9412/9413 (364 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele