WormBase Tree Display for Variation: WBVar00250241
expand all nodes | collapse all nodes | view schema
WBVar00250241 | Name | Public_name | tm1233 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F42A6.9.1:c.498_677-43del | |||||||
HGVSg | CHROMOSOME_IV:g.3347150_3347714del | |||||||
Sequence_details | SMap | S_parent | Sequence | F42A6 | ||||
Flanking_sequences | agactgtgtaagagattcctaggccaggtg | tattcgactttcagctgctcgtactctctc | ||||||
Mapping_target | F42A6 | |||||||
Source_location | 7 | CHROMOSOME_IV | 3347149 | 3347715 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product (2) | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1233 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00018330 | ||||||
Transcript | F42A6.9.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F42A6.9.1:c.498_677-43del | |||||||
cDNA_position | 607-? | |||||||
CDS_position | 498-? | |||||||
Protein_position | 166-? | |||||||
Intron_number | 5-6/11 | |||||||
Exon_number | 5-6/12 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Mapping_data | In_multi_point | 5073 | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. Y. Jin: same as reported by Denken et al.(2005). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000436 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. M. Zhen: no SYD-2::GFP localization defects in GABAergic neurons; Dr. C. Bargmann: normal GFP::UNC-2 localization. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. C. Bargmann: locomotion OK. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000672 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. K. Shen to the National Bioresource Project of Japan: HSN presynaptic vesicle localization normal. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | TV | |||||||
WBPhenotype:0000847 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. K. Shen: HSN presynaptic components (syd-2, syd-1, GIT-1, SAD-1) localization normal; Dr. C. Bargmann: normal GFP::UNC-2 localization. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 27776/27777-28341/28342 (565 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |