WormBase Tree Display for Variation: WBVar00250241

WBVar00250241 Name: Public_name: tm1233
    Other_name: F42A6.9.1:c.498_677-43del
    HGVSg: CHROMOSOME_IV:g.3347150_3347714del
  Sequence_details: SMap: S_parent: Sequence: F42A6
    Flanking_sequences: agactgtgtaagagattcctaggccaggtg tattcgactttcagctgctcgtactctctc
    Mapping_target: F42A6
    Source_location: 7 CHROMOSOME_IV 3347149 3347715 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1233_external
      tm1233_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1233
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00018330
    Transcript: F42A6.9.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F42A6.9.1:c.498_677-43del
        cDNA_position: 607-?
        CDS_position: 498-?
        Protein_position: 166-?
        Intron_number: 5-6/11
        Exon_number: 5-6/12
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
    Mapping_data: In_multi_point: 5073
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. Y. Jin: same as reported by Denken et al.(2005). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000436 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. M. Zhen: no SYD-2::GFP localization defects in GABAergic neurons; Dr. C. Bargmann: normal GFP::UNC-2 localization. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. C. Bargmann: locomotion OK. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000672 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. K. Shen to the National Bioresource Project of Japan: HSN presynaptic vesicle localization normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: TV
      WBPhenotype:0000847 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Shen: HSN presynaptic components (syd-2, syd-1, GIT-1, SAD-1) localization normal; Dr. C. Bargmann: normal GFP::UNC-2 localization. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark (2)
  Method: NBP_knockout_allele