WormBase Tree Display for Variation: WBVar00250731
expand all nodes | collapse all nodes | view schema
WBVar00250731 | Name | Public_name | tm1766 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y4C6A.2d.1:c.505-222_783-59del | |||||||
Y4C6A.2a.1:c.505-222_783-59del | ||||||||
HGVSg | CHROMOSOME_IV:g.5441508_5442315del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y4C6A | ||||
Flanking_sequences | gaaattagcaaaaagcgaaacataacattc | gtaccccaaatttcaaagagaaatcatgaa | ||||||
Mapping_target | Y4C6A | |||||||
Source_location | 7 | CHROMOSOME_IV | 5441507 | 5442316 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1766_external | |||||||
tm1766_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1766 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00048429 | ||||||
WBGene00021152 | ||||||||
WBGene00165129 | ||||||||
Transcript | Y4C6A.14 | |||||||
Y4C6A.21 | ||||||||
Y4C6A.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y4C6A.2a.1:c.505-222_783-59del | |||||||
Intron_number | 3-5/19 | |||||||
Exon_number | 4-5/20 | |||||||
Y4C6A.2d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y4C6A.2d.1:c.505-222_783-59del | |||||||
Intron_number | 3-5/19 | |||||||
Exon_number | 4-5/20 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00060924 | ||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | One day old adult worms were placed on Aldicarb (0.1 mM) plates. | Paper_evidence | WBPaper00060924 | ||||
Curator_confirmed | WBPerson557 | |||||||
Temperature | 20 | Paper_evidence | WBPaper00060924 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00060924 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Levamisole assays were carried out on NGM plates with 200 M Levamisole. | Paper_evidence | WBPaper00060924 | ||||
Curator_confirmed | WBPerson557 | |||||||
Temperature | 20 | Paper_evidence | WBPaper00060924 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0000006 | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | All these animals retained a similar number of eggs when compared to wild-type animals (~10 eggs). | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Young well-fed animals were scored | Paper_evidence | WBPaper00032082 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 25 | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000019 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals did not exhibit reduced pharyngeal pumping when compared with daf-7(e1375). | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Pumping rates were assayed for well-fed , pheromone-untreated; food-deprived, pheromone-untreated; and well-fed, pheromone-treated animals. Pheromone treatment consisted of transfer of animals grown under well-fed conditions to plates containing 30 ul/ml of a dauer-pheromone prep (Golden and Riddle, 1982) and 30 ml of OP50 E. coli food. | Paper_evidence | WBPaper00032082 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 20 | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000030 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. Y. Jin: grows well. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | CZ | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000478 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. I. Mori to the National Bioresource Project of Japan: normal thermotaxis. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001182 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. K. Ashrafi: normal Sudan Black B staining. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KQ | |||||||
WBPhenotype:0001183 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Fat levels were reduced when compared to daf-7(e1375) as determined by Sudan Black assay (described in Kimura et al., 1997). | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | To minimize staining variability, which allowed for quantitative comparisons between various genotypes: animals from one genotype were labeled with fluorescein isothiocyanate (FITC) and then fixed and stained in the same tube as unlabeled animals from another genotype. | Paper_evidence | WBPaper00032082 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 22 | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001206 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. Y. Jin: no movement phenotype. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | CZ | |||||||
Disease_info | Models_disease | DOID:10652 | ||||||
Models_disease_in_annotation | WBDOannot00001430 | |||||||
Reference | WBPaper00032082 | |||||||
WBPaper00060924 | ||||||||
Remark | 13745/13746-14553/14554 (808 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |