WormBase Tree Display for Variation: WBVar00250794
expand all nodes | collapse all nodes | view schema
WBVar00250794 | Name | Public_name | tm1830 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | K04F10.2.1:c.627_779-155del | ||||||||
HGVSg | CHROMOSOME_I:g.6362101_6362447del | ||||||||
Sequence_details | SMap | S_parent | Sequence | K04F10 | |||||
Flanking_sequences | cttgataagtttacctgaagaaccaatttc | gaaaatgaatttataattcattgtctatat | |||||||
Mapping_target | K04F10 | ||||||||
Source_location | 7 | CHROMOSOME_I | 6362100 | 6362448 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm1830_external | ||||||||
tm1830_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1830 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00019395 | |||||||
Transcript | K04F10.2.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | K04F10.2.1:c.627_779-155del | ||||||||
cDNA_position | 633-? | ||||||||
CDS_position | 627-? | ||||||||
Protein_position | 209-? | ||||||||
Intron_number | 5/11 | ||||||||
Exon_number | 5/12 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | I | |||||||
Description | Phenotype | WBPhenotype:0000262 | Paper_evidence | WBPaper00049039 | |||||
Curator_confirmed | WBPerson2216 | ||||||||
Remark | Animals exhibit defects in the A-tubule of a ciliary axoneme | Paper_evidence | WBPaper00049039 | ||||||
Curator_confirmed | WBPerson2216 | ||||||||
EQ_annotations | GO_term | GO:0097649 | PATO:0000460 | Paper_evidence | WBPaper00049039 | ||||
Curator_confirmed | WBPerson2216 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000249 | Paper_evidence | WBPaper00049039 | |||||||
Curator_confirmed | WBPerson2216 | ||||||||
WBPhenotype:0000662 | Paper_evidence | WBPaper00049039 | |||||||
Curator_confirmed | WBPerson2216 | ||||||||
WBPhenotype:0000663 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. O. Blacque: normal osmolarity sensing. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0001468 | Paper_evidence | WBPaper00049039 | |||||||
Curator_confirmed | WBPerson2216 | ||||||||
WBPhenotype:0002211 | Paper_evidence | WBPaper00049039 | |||||||
Curator_confirmed | WBPerson2216 | ||||||||
WBPhenotype:0002212 | Paper_evidence | WBPaper00049039 | |||||||
Curator_confirmed | WBPerson2216 | ||||||||
WBPhenotype:0002535 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. O. Blacque: normal dye filling | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
Reference | WBPaper00049039 | ||||||||
Remark | 29915/29916-30262/30263 (347 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |