WormBase Tree Display for Variation: WBVar00250892

WBVar00250892 Name: Public_name: tm1931
    HGVSg: CHROMOSOME_V:g.3984468_3984961delinsAAAA
  Sequence_details: SMap: S_parent: Sequence: B0213
    Flanking_sequences: aaaacaaaaatgatttcaacctcttcaatt aaaattacagtagaggagcttattttgaaa
    Mapping_target: B0213
    Source_location: 7 CHROMOSOME_V 3984467 3984962 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AAAA
      Deletion
    PCR_product: tm1931_external
      tm1931_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1931
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003767
    Transcript: B0213.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: 44-?
        CDS_position: 22-?
        Protein_position: 8-?
        Intron_number: 2/3
        Exon_number: 2-4/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000039 Paper_evidence: WBPaper00032031
        Curator_confirmed: WBPerson712
        Remark: No marked difference in lifespan, in the absence of infection, was observed compared to wild type. Paper_evidence: WBPaper00032031
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00032031
            Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000072 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: grossly normal morphology. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000145 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: grossly normal fertility. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000639 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: does not form dauer at 25C. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0001014 Paper_evidence: WBPaper00032031
        Curator_confirmed: WBPerson712
        Remark: No marked change in resistance to D. coniospora infection was observed compared to wild type. Paper_evidence: WBPaper00032031
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00032031
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Infections with a freshly harvested solution of D. coniospora spores were done as described [65]; worms were analyzed after 24 h at 25C. Worms were pricked in the tail region using a microinjection needle under a dissecting microscope and analyzed 6 h later for GFP induction or 2 hours later for qRT-PCR. Paper_evidence: WBPaper00032031
              Curator_confirmed: WBPerson712
  Reference: WBPaper00032031
  Remark: 32394/32395-AAAA-32888/32889 (494 bp deletion + 4 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele