WormBase Tree Display for Variation: WBVar00250993
expand all nodes | collapse all nodes | view schema
WBVar00250993 | Name | Public_name | tm2047 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_III:g.8913655_8914161delinsC | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK637 | ||||
Flanking_sequences | taatagtatgagattaaaattttcatttta | tcaaagaatgtgaatgatcgagtaaaagca | ||||||
Mapping_target | ZK637 | |||||||
Source_location | 7 | CHROMOSOME_III | 8913654 | 8914162 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | C | ||||||
Deletion | ||||||||
PCR_product | tm2047_external | |||||||
tm2047_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00040310 | |||||||
WBStrain00040312 | ||||||||
WBStrain00040314 | ||||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2047 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00014028 | ||||||
Transcript | ZK637.10.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-345 | |||||||
CDS_position | ?-333 | |||||||
Protein_position | ?-111 | |||||||
Intron_number | 2/7 | |||||||
Exon_number | 1-3/8 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Mapping_data | In_multi_point | 5518 | ||||||
Description | Phenotype | WBPhenotype:0001937 | Paper_evidence | WBPaper00040582 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Interestingly, unlike dvIs2 worms, we managed to generate Aβ dvIs100 animals in a trxr-2 (tm2047) mutant background and confirmed their increased paralysis when compared with its respective control (Fig. 8B)." | Paper_evidence | WBPaper00040582 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | dvIs100 [Punc-54::A-beta-1-42::unc-54 3'-UTR] | Paper_evidence | WBPaper00040582 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed (12) | ||||||||
Disease_info | Modifies_disease | DOID:10652 | ||||||
Modifies_disease_in_annotation | WBDOannot00000109 | |||||||
Reference | WBPaper00040582 | |||||||
Remark | 29689/29690-C-30196/30197 (507 bp deletion + 1 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |