WormBase Tree Display for Variation: WBVar00251028

WBVar00251028 Name: Public_name: tm2088
    Other_name: K08E3.3b.1:c.27_477del
      CE37124:p.Val10LysfsTer13
      CE37123:p.Val10LysfsTer13
      K08E3.3a.1:c.27_477del
    HGVSg: CHROMOSOME_III:g.13756025_13756661del
  Sequence_details: SMap: S_parent: Sequence: K08E3
    Flanking_sequences: tcaaatgattcccgtttctagatttttcac aaagctgataaaaatctggaaatttcgcgg
    Mapping_target: K08E3
    Source_location: 7 CHROMOSOME_III 13756024 13756662 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2088_external
      tm2088_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2088
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00010663
    Transcript: K08E3.3b.1 (11)
      K08E3.3a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000646 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Subramaniam: slightly slower movement. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: IT
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 15307/15308-15944/15945 (637 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele