WormBase Tree Display for Variation: WBVar00251072
expand all nodes | collapse all nodes | view schema
WBVar00251072 | Name | Public_name | tm2133 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F56E10.2b.1:c.1288-342_1628del | ||||||||
F56E10.2a.1:c.1795-342_2135del | |||||||||
F56E10.2a.2:c.1795-342_2135del | |||||||||
HGVSg | CHROMOSOME_V:g.66953_67635del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F56E10 | |||||
Flanking_sequences | tgacatgacgacgtggctttcagcacgact | ggtaaactaaaagaaaaagatcgacccgag | |||||||
Mapping_target | F56E10 | ||||||||
Source_location | 7 | CHROMOSOME_V | 66952 | 67636 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm2133_external | ||||||||
tm2133_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 2133 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00018976 | |||||||
Transcript | F56E10.2c.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | ?-299 | ||||||||
CDS_position | ?-299 | ||||||||
Protein_position | ?-100 | ||||||||
Exon_number | 1/3 | ||||||||
F56E10.2a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F56E10.2a.1:c.1795-342_2135del | ||||||||
cDNA_position | ?-2197 | ||||||||
CDS_position | ?-2135 | ||||||||
Protein_position | ?-712 | ||||||||
Intron_number | 10/13 | ||||||||
Exon_number | 11/14 | ||||||||
F56E10.2a.2 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F56E10.2a.2:c.1795-342_2135del | ||||||||
cDNA_position | ?-2197 | ||||||||
CDS_position | ?-2135 | ||||||||
Protein_position | ?-712 | ||||||||
Intron_number | 10/14 | ||||||||
Exon_number | 11/15 | ||||||||
F56E10.2b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F56E10.2b.1:c.1288-342_1628del | ||||||||
cDNA_position | ?-1628 | ||||||||
CDS_position | ?-1628 | ||||||||
Protein_position | ?-543 | ||||||||
Intron_number | 4/6 | ||||||||
Exon_number | 5/7 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | V | |||||||
Mapping_data | In_multi_point | 5580 | |||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000646 | Paper_evidence | WBPaper00041258 | |||||||
Curator_confirmed | WBPerson3809 | ||||||||
Remark | slow-moving animals. | Paper_evidence | WBPaper00041258 | ||||||
Curator_confirmed | WBPerson3809 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00041258 | |||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson3809 | |||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | FX | ||||||||
results in sterility | Paper_evidence | WBPaper00041258 | |||||||
Curator_confirmed | WBPerson3809 | ||||||||
Phenotype_not_observed | WBPhenotype:0000031 | Paper_evidence | WBPaper00046877 | ||||||
Curator_confirmed | WBPerson3809 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00046877 | ||||
Curator_confirmed | WBPerson3809 | ||||||||
WBPhenotype:0000052 | Paper_evidence | WBPaper00046877 | |||||||
Curator_confirmed | WBPerson3809 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00046877 | ||||
Curator_confirmed | WBPerson3809 | ||||||||
WBPhenotype:0000625 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Comment from Dr. K. Shen to the National Bioresource Project of Japan: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000683 | Paper_evidence | WBPaper00046877 | |||||||
Curator_confirmed | WBPerson3809 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00046877 | ||||
Curator_confirmed | WBPerson3809 | ||||||||
Reference | WBPaper00041258 | ||||||||
WBPaper00046877 | |||||||||
Remark | 1430/1431-2113/2114 (683 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |