WormBase Tree Display for Variation: WBVar00251143
expand all nodes | collapse all nodes | view schema
WBVar00251143 | Name | Public_name | tm2217 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C08F8.8.1:c.367-230_807-48del | ||||||||
HGVSg | CHROMOSOME_IV:g.11172919_11174002del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C08F8 | |||||
Flanking_sequences | tattctggggcagatgttttaatgtttcta | gtaccatctttccttctgaaaacttcacag | |||||||
Mapping_target | C08F8 | ||||||||
Source_location | 7 | CHROMOSOME_IV | 11172918 | 11174003 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm2217_external | ||||||||
tm2217_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027634 | ||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 2217 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003657 | |||||||
Transcript | C08F8.8.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C08F8.8.1:c.367-230_807-48del | ||||||||
Intron_number | 5-7/9 | ||||||||
Exon_number | 6-7/10 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | IV | |||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00039839 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All tm2217 homozygous escaper adults had egg-laying defective (Egl) phenotypes. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000073 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Arrested L1 larvae displayed variable defects in tail morphology, including kinks, bulges, and forks. Tail morphology defects were not observed in later stage escapers. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000081 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Homozygous mutants usually arrested development as embryos or L1 larvae. Less than 10% of tm2217 homozygous animals developed to adulthood. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00039839 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All tm2217 homozygous escaper adults produced a small number (1-5) of progeny that invariably arrested at or before the L1 stage. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Arrested L1 appeared slightly uncoordinated in comparison to heterozygous sisters. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All tm2217 homozygous escaper adults had protruding vulva (Pvl). | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000708 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Arrested L1 larvae had grossly normal intestines. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000709 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Arrested L1 larvae had grossly normal pharynxes. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000778 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Over 90% of arrested larvae did not have any bacteria in their gut, suggesting that most nhr-67 homozygous mutantsare unable to eat. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000867 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Homozygous mutants usually arrested development as embryos or L1 larvae. Less than 10% of tm2217 homozygous animals developed to adulthood. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Arrested L1 larvae had grossly normal cuticular alae. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00039839 | ||||||||
Remark | 24339/24340-25423/25424 (1081 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |