WormBase Tree Display for Variation: WBVar00251176
expand all nodes | collapse all nodes | view schema
WBVar00251176 | Name | Public_name | tm2262 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | K04D7.1.2:c.121_408del | |||||||
K04D7.1.1:c.121_408del | ||||||||
K04D7.1.3:c.121_408del | ||||||||
CE06090:p.Thr41_Ter136delextTer? | ||||||||
HGVSg | CHROMOSOME_IV:g.10176878_10177208del | |||||||
Sequence_details | SMap | S_parent | Sequence | K04D7 | ||||
Flanking_sequences | tcaaatttatactcacatttttcagacaag | ctgtggaacactcttgcccagtgcaagtac | ||||||
Mapping_target | K04D7 | |||||||
Source_location | 7 | CHROMOSOME_IV | 10176877 | 10177209 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2262_external | |||||||
tm2262_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00024150 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2262 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00010556 | ||||||
Transcript | K04D7.1.1 (11) | |||||||
K04D7.1.3 (11) | ||||||||
K04D7.1.2 (11) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. E. Lundquist to the National Bioresource Project of Japan: slow-growing. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | LE | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Originally classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. Y. Jin: unable to homozygous the mutants. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | CZ | |||||||
FX | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. E. Lundquist to the National Bioresource Project of Japan: semi-sterile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | LE | |||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00051118 | ||||||
Curator_confirmed | WBPerson38423 | |||||||
Remark | Lethargus duration increased by 72%; total sleep increased by 133%; Bout duration increased by 59% (Table 2A) | Paper_evidence | WBPaper00051118 | |||||
Curator_confirmed | WBPerson38423 | |||||||
Phenotype_not_observed | WBPhenotype:0000104 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan: Dr. H.C. Korswagen: no ALM/PLM polarity defects in the F1 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KN | |||||||
WBPhenotype:0000469 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan: Dr. H.C. Korswagen: no QL migration defect | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KN | |||||||
Reference | WBPaper00051118 | |||||||
Remark | 8118/8119-8449/8450 (331 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |