WormBase Tree Display for Variation: WBVar00251564

WBVar00251564 Name: Public_name: tm2720
    Other_name: B0024.9a.1:c.264_*43del
    HGVSg: CHROMOSOME_V:g.10315036_10315253del
  Sequence_details: SMap: S_parent: Sequence: B0024
    Flanking_sequences: atcctttcaggtaaacggaagacaaggaag tttaatggttcatttaaattagaggaataa
    Mapping_target: B0024
    Source_location: 7 CHROMOSOME_V 10315035 10315254 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2720_external
      tm2720_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00040311
      WBStrain00040314
      WBStrain00040316
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2720
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007100
      WBGene00007099
    Transcript: B0024.9b.1 VEP_consequence: coding_sequence_variant,3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 186-?
        CDS_position: 186-?
        Protein_position: 62-?
        Exon_number: 3/3
      B0024.10.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 1832-?
        Exon_number: 6/6
      B0024.9a.1 VEP_consequence: stop_lost,3_prime_UTR_variant
        VEP_impact: HIGH
        HGVSc: B0024.9a.1:c.264_*43del
        cDNA_position: 264-481
        CDS_position: 264-?
        Protein_position: 88-?
        Exon_number: 3-4/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000124 Paper_evidence: WBPaper00040582
        Curator_confirmed: WBPerson2987
        Remark: "The conceptual translation of the tm2720 mRNA variant produces a truncated protein (ΔTRX-2) that lacks the C-terminal half of the mature wild-type TRX-2 protein, which contains amino acid residues critical for protein-protein interaction and redox active-site stabilization (11). Consistent with this analysis, recombinant ΔTRX-2 is devoid of enzymatic activity in both the 1,4-dithio-D-threitol (DTT) and reduced nicotinamide adenine dinucleotide phosphate (NADPH)/thioredoxin reductase assay as compared with that of mature full-length TRX-2 (Fig. 1E, F), thus supporting the notion that the tm2720 allele is a loss-of-function allele." Paper_evidence: WBPaper00040582
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000295 Paper_evidence: WBPaper00040582
        Curator_confirmed: WBPerson2987
        Remark: "No significant differences in sensitivity were found with arsenite, juglone, sodium azide, paraquat or thermal stress treatments (Fig. 5A-E), although the trx-2 (tm2720) mutant was slightly more resistant to thermal stress and trx-2 (tm2720) single and trx-2 (tm2720); trxr-2(tm2047) double mutant showed a slightly higher resistance to paraquat treatment." Paper_evidence: WBPaper00040582
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: Animals were grown at 37 degrees Celsius and assayed for survival over time Paper_evidence: WBPaper00040582
              Curator_confirmed: WBPerson2987
          Temperature: 37 Paper_evidence: WBPaper00040582
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000461 Paper_evidence: WBPaper00040582
        Curator_confirmed: WBPerson2987
        Remark: "No significant differences in sensitivity were found with arsenite, juglone, sodium azide, paraquat or thermal stress treatments (Fig. 5A-E), although the trx-2 (tm2720) mutant was slightly more resistant to thermal stress and trx-2 (tm2720) single and trx-2 (tm2720); trxr-2(tm2047) double mutant showed a slightly higher resistance to paraquat treatment." Paper_evidence: WBPaper00040582
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00002747 Paper_evidence: WBPaper00040582
              Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: Animals were exposed to 4 mM paraquat and assayed for survival over time Paper_evidence: WBPaper00040582
              Curator_confirmed: WBPerson2987
    Phenotype_not_observed (11)
  Reference: WBPaper00040582
  Remark: 28467/28468-28685/28686 (218 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele