WormBase Tree Display for Variation: WBVar00251585
expand all nodes | collapse all nodes | view schema
| WBVar00251585 | Name | Public_name | tm2743 | |||||
|---|---|---|---|---|---|---|---|---|
| HGVSg | CHROMOSOME_I:g.10568974_10569777del | |||||||
| Sequence_details | SMap | S_parent | Sequence | F25H2 | ||||
| Flanking_sequences | gattcggtctcttcgactaaatccacaagt | ggatcgcttcaagaacctcgccttcttcat | ||||||
| Mapping_target | F25H2 | |||||||
| Source_location | 7 | CHROMOSOME_I | 10568973 | 10569778 | Inferred_automatically | National_Bioresource_Project | ||
| Type_of_mutation | Deletion | |||||||
| PCR_product | tm2743_external | |||||||
| tm2743_internal | ||||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Laboratory | FX | |||||||
| Author | Mitani S | |||||||
| DB_info | Database | National_Bioresource_Project | seq | 2743 | ||||
| NBP_allele | ||||||||
| Status | Live | |||||||
| Affects (2) | ||||||||
| Isolation | Mutagen | TMP/UV | ||||||
| Genetics | Map | I | ||||||
| Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson48 | |||||||
| Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson48 | |||||||
| Laboratory_evidence | FX | |||||||
| WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson48 | |||||||
| Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson48 | |||||||
| Laboratory_evidence | FX | |||||||
| Phenotype_not_observed | WBPhenotype:0000643 | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson48 | |||||||
| Remark | Comments to the National Bioresource Project of Japan: Dr. K. Subramaniam: normal locomotion. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson48 | |||||||
| Laboratory_evidence | FX | |||||||
| Remark | 35066/35067-35870/35871 (804 bp deletion) | |||||||
| This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
| Method | NBP_knockout_allele |
