WormBase Tree Display for Variation: WBVar00252110
expand all nodes | collapse all nodes | view schema
WBVar00252110 | Name | Public_name | tm3425 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C56C10.12.1:c.474_1139-23del | |||||||
HGVSg | CHROMOSOME_II:g.6608000_6608738del | |||||||
Sequence_details | SMap | S_parent | Sequence | F54H5 | ||||
Flanking_sequences | ggcaattactgaaatacattcatattcaac | ggatgttgaagcgcatcagtataggatgga | ||||||
Mapping_target | F54H5 | |||||||
Source_location | 7 | CHROMOSOME_II | 6607999 | 6608739 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm3425_external | |||||||
tm3425_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00055854 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 3425 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00016968 | ||||||
Transcript | C56C10.12.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C56C10.12.1:c.474_1139-23del | |||||||
cDNA_position | 483-? | |||||||
CDS_position | 474-? | |||||||
Protein_position | 158-? | |||||||
Intron_number | 5-6/24 | |||||||
Exon_number | 5-6/25 | |||||||
Interactor | WBInteraction000517937 | |||||||
WBInteraction000521392 | ||||||||
WBInteraction000521394 | ||||||||
WBInteraction000521400 | ||||||||
WBInteraction000521401 | ||||||||
WBInteraction000521408 | ||||||||
WBInteraction000525233 | ||||||||
WBInteraction000525258 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype (11) | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000590 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | epg-5(tm3425) mutants did not exhibit changes in the number of germ cell corpses that were observed in animals 48 hours post-L4 larval stage (Figure S1E) | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000699 | Paper_evidence | WBPaper00042320 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Autophagy mutants did not show defects in vulval development. | Paper_evidence | WBPaper00042320 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000701 | Paper_evidence | WBPaper00042320 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants exhibited normal seam cell development | Paper_evidence | WBPaper00042320 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001225 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. H. Sawa: not Psa | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Reference | WBPaper00036384 | |||||||
WBPaper00042320 | ||||||||
WBPaper00044390 | ||||||||
WBPaper00065712 | ||||||||
Remark | 33713/33714-34452/34453 (739 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target C56C10 updated based on the VEP analysis pipeline to F54H5. | ||||||||
Method | NBP_knockout_allele |