WormBase Tree Display for Variation: WBVar00252217

WBVar00252217 Name: Public_name: tm3560
    Other_name (13)
    HGVSg: CHROMOSOME_V:g.4501482_4501912delinsC
  Sequence_details: SMap: S_parent: Sequence: T28F12
    Flanking_sequences: ttgtgcctgtttttttttcaaaattaaaca acagacccaagagaatgctgacaagcagta
    Mapping_target: T28F12
    Source_location: 7 CHROMOSOME_V 4501481 4501913 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: C
      Deletion
    PCR_product: tm3560_external
      tm3560_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3560
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006796
    Transcript (13)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 4036/4037-C-4467/4468 (431 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele