WormBase Tree Display for Variation: WBVar00252258

WBVar00252258 Name: Public_name: tm3620
    Other_name: ZK75.1.1:c.85_235+2del
    HGVSg: CHROMOSOME_II:g.5996480_5996632del
  Sequence_details: SMap: S_parent: Sequence: ZK75
    Flanking_sequences: tgtcgacaaccttccatggacaccagcaaa acgtttaatgctaaaaattttttaaaaaac
    Mapping_target: ZK75
    Source_location: 7 CHROMOSOME_II 5996479 5996633 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3620_external
      tm3620_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3620
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002087
    Transcript: ZK75.1.1 VEP_consequence: splice_donor_variant,coding_sequence_variant
        VEP_impact: HIGH
        HGVSc: ZK75.1.1:c.85_235+2del
        cDNA_position: 115-?
        CDS_position: 85-?
        Protein_position: 29-?
        Intron_number: 2/3
        Exon_number: 2/4
    Interactor (40)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed (8)
  Reference: WBPaper00042184
  Remark: 17584/17585-17737/17738 (153 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele