WormBase Tree Display for Variation: WBVar00252465
expand all nodes | collapse all nodes | view schema
WBVar00252465 | Name | Public_name | tm3874 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F09E8.7b.1:c.960+74_961-24delinsA | |||||||
F09E8.7a.1:c.1035+74_1036-24delinsA | ||||||||
HGVSg | CHROMOSOME_IV:g.13175553_13176068delinsT | |||||||
Sequence_details | SMap | S_parent | Sequence | F58D2 | ||||
Flanking_sequences | ggagaatctgaaattaacattttacttgtg | ggaaataaggaaatgtatgactttttaatt | ||||||
Mapping_target | F58D2 | |||||||
Source_location | 7 | CHROMOSOME_IV | 13175552 | 13176069 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | T | ||||||
Deletion | ||||||||
PCR_product | tm3874_external | |||||||
tm3874_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 3874 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002974 | ||||||
Transcript | F09E8.7a.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | F09E8.7a.1:c.1035+74_1036-24delinsA | |||||||
Intron_number | 5/9 | |||||||
F09E8.7b.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | F09E8.7b.1:c.960+74_961-24delinsA | |||||||
Intron_number | 6/10 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 38139/18140-T-38655/38656 (516 bp deletion + 1 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target F09E8 updated based on the VEP analysis pipeline to F58D2. | ||||||||
Method | NBP_knockout_allele |