WormBase Tree Display for Variation: WBVar00252614
expand all nodes | collapse all nodes | view schema
WBVar00252614 | Name | Public_name | tm4059 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | H23L24.3b.1:c.565+29_860del | ||||||||
H23L24.3a.1:c.265+29_560del | |||||||||
HGVSg | CHROMOSOME_IV:g.8700363_8700869del | ||||||||
Sequence_details | SMap | S_parent | Sequence | H23L24 | |||||
Flanking_sequences | aggtaagatgataatacatttttttgaact | gatgaatgataaattgaagttcgattttcg | |||||||
Mapping_target | H23L24 | ||||||||
Source_location | 7 | CHROMOSOME_IV | 8700362 | 8700870 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm4059_external | ||||||||
tm4059_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00054964 | ||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 4059 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00019230 | |||||||
Transcript | H23L24.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | H23L24.3b.1:c.565+29_860del | ||||||||
cDNA_position | ?-861 | ||||||||
CDS_position | ?-860 | ||||||||
Protein_position | ?-287 | ||||||||
Intron_number | 5-7/17 | ||||||||
Exon_number | 6-8/18 | ||||||||
H23L24.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | H23L24.3a.1:c.265+29_560del | ||||||||
cDNA_position | ?-564 | ||||||||
CDS_position | ?-560 | ||||||||
Protein_position | ?-187 | ||||||||
Intron_number | 3-5/15 | ||||||||
Exon_number | 4-6/16 | ||||||||
Interactor | WBInteraction000563338 | ||||||||
WBInteraction000563340 | |||||||||
WBInteraction000563345 | |||||||||
WBInteraction000563346 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | IV | |||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000262 | Paper_evidence | WBPaper00053343 | |||||||
Curator_confirmed | WBPerson3755 | ||||||||
Remark | Fig. 6: in CEM cilia, loss of ttll-11 causes abnormally long doublet microtubule region in the axoneme | Paper_evidence | WBPaper00053343 | ||||||
Curator_confirmed | WBPerson3755 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00053343 | ||||||
Curator_confirmed | WBPerson3755 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00053343 | |||||||
Curator_confirmed | WBPerson3755 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00053343 | ||||||
Curator_confirmed | WBPerson3755 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005246 | PATO:0000460 | Paper_evidence | WBPaper00053343 | ||||
Curator_confirmed | WBPerson3755 | ||||||||
GO_term | GO:0097545 | PATO:0000573 | Paper_evidence | WBPaper00053343 | |||||
Curator_confirmed | WBPerson3755 | ||||||||
Phenotype_assay | Genotype | myIs1[pkd-2::gfp + Punc-122::gfp] pkd-2(sy606);him-5(e1490) | Paper_evidence | WBPaper00053343 | |||||
Curator_confirmed | WBPerson3755 | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0001242 | Paper_evidence | WBPaper00053343 | |||||||
Curator_confirmed | WBPerson3755 | ||||||||
Remark | Table 1: Kinesin-2 and Kinesin-3 velocities in cilia affected by loss of ttll-11 in CEM male specific neurons | Paper_evidence | WBPaper00053343 | ||||||
Curator_confirmed | WBPerson3755 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00053343 | ||||||
Curator_confirmed | WBPerson3755 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00053343 | |||||||
Curator_confirmed | WBPerson3755 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00053343 | ||||||
Curator_confirmed | WBPerson3755 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005246 | PATO:0000460 | Paper_evidence | WBPaper00053343 | ||||
Curator_confirmed | WBPerson3755 | ||||||||
Phenotype_assay | Genotype | myIs1[pkd-2::gfp + Punc-122::gfp] pkd-2(sy606);him-5(e1490) | Paper_evidence | WBPaper00053343 | |||||
Curator_confirmed | WBPerson3755 | ||||||||
Phenotype_not_observed | WBPhenotype:0000050 | Paper_evidence | WBPaper00050134 | ||||||
Curator_confirmed | WBPerson10283 | ||||||||
WBPhenotype:0000663 | Paper_evidence | WBPaper00050134 | |||||||
Curator_confirmed | WBPerson10283 | ||||||||
WBPhenotype:0000673 | Paper_evidence | WBPaper00050134 | |||||||
Curator_confirmed | WBPerson10283 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00050134 | |||||||
Curator_confirmed | WBPerson10283 | ||||||||
WBPhenotype:0002212 | Paper_evidence | WBPaper00050134 | |||||||
Curator_confirmed | WBPerson10283 | ||||||||
Reference | WBPaper00050134 | ||||||||
WBPaper00053343 | |||||||||
Remark | 8296/8297-8803/8804 (507 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |