WormBase Tree Display for Variation: WBVar00252818
expand all nodes | collapse all nodes | view schema
WBVar00252818 | Name | Public_name | tm4313 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y50D7A.3a.1:c.105+384_163delinsAAAAAAGAAAATAAAAAAAA | |||||||
Y50D7A.3b.1:c.105+384_163delinsAAAAAAGAAAATAAAAAAAA | ||||||||
HGVSg | CHROMOSOME_III:g.255047_256154delinsAAAAAAGAAAATAAAAAAAA | |||||||
Sequence_details | SMap | S_parent | Sequence | Y50D7A | ||||
Flanking_sequences | tccaaaaaattaaattttttgagcaaaaaa | agcattttgcagtgaaaattgtcgatattt | ||||||
Mapping_target | Y50D7A | |||||||
Source_location | 7 | CHROMOSOME_III | 255046 | 256155 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | AAAAAAGAAAATAAAAAAAA | ||||||
Deletion | ||||||||
PCR_product | tm4313_external | |||||||
tm4313_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 4313 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00021753 | ||||||
Transcript | Y50D7A.3b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y50D7A.3b.1:c.105+384_163delinsAAAAAAGAAAATAAAAAAAA | |||||||
cDNA_position | ?-187 | |||||||
CDS_position | ?-163 | |||||||
Protein_position | ?-55 | |||||||
Intron_number | 2/7 | |||||||
Exon_number | 3/8 | |||||||
Y50D7A.3a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y50D7A.3a.1:c.105+384_163delinsAAAAAAGAAAATAAAAAAAA | |||||||
cDNA_position | ?-187 | |||||||
CDS_position | ?-163 | |||||||
Protein_position | ?-55 | |||||||
Intron_number | 2/8 | |||||||
Exon_number | 3/9 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Classified as Gro by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | 34192/34193-AAAAAAGAAAATAAAAAAAA-35300/35301 (1108 bp deletion + 20 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |