WormBase Tree Display for Variation: WBVar00252888
expand all nodes | collapse all nodes | view schema
WBVar00252888 | Name | Public_name | tm4391 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C34G6.5.1:c.375_589del | |||||||
CE26909:p.Tyr126ArgfsTer10 | ||||||||
HGVSg | CHROMOSOME_I:g.5872746_5873063del | |||||||
Sequence_details | SMap | S_parent | Sequence | C34G6 | ||||
Flanking_sequences | ttcaaaacgagatctttcatttgctctctc | aaggtacatcgtcaccgtgtatgttttgta | ||||||
Mapping_target | C34G6 | |||||||
Source_location | 7 | CHROMOSOME_I | 5872745 | 5873064 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm4391_external | |||||||
tm4391_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00047819 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 4391 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00016421 | ||||||
Transcript | C34G6.5.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as Gro by the National Bioresource Project of Japan | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00055989 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | cdc-7(tm4391) worms are temperature sensitive sterile, with higher temperatures being progressively worse for fecundity. At 25 degC, 90% of individual worms tested were sterile (Total n= 48. Number of plates with progeny = 3, number without progeny = 45). There was an intermediate effect at 20 degC with 56% sterility (Total n= 49. Number of plates with progeny = 21, number without progeny = 28). cdc-7(tm4391) was most fertile when kept at 16 degC, with only 30% sterility (Total n= 49. Number of plates with progeny = 35, number without progeny = 14). N2 controls had no observed sterility at any temperatures (for 25 degC, 20 degC and 16 degC respectively, total n= 50, 50, 50. Number of plates with progeny = 50, 50, 50). | Paper_evidence | WBPaper00055989 | |||||
Curator_confirmed | WBPerson712 | |||||||
Image | WBPicture0000014384 | Paper_evidence | WBPaper00055989 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 20, 25 | Paper_evidence | WBPaper00055989 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 16, 22, 25 | Paper_evidence | WBPaper00055989 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | CK609 CK609 cdc-7(tm4391) I - outcrossed 4x to N2 | Paper_evidence | WBPaper00055989 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002327 | Paper_evidence | WBPaper00046077 | ||||||
Curator_confirmed | WBPerson3637 | |||||||
Remark | suppressors of TDP-43 transgene induced uncoordination | Paper_evidence | WBPaper00046077 | |||||
Curator_confirmed | WBPerson3637 | |||||||
Disease_info | Modifies_disease | DOID:332 | ||||||
DOID:9255 | ||||||||
DOID:0060201 | ||||||||
Modifies_disease_in_annotation | WBDOannot00000773 | |||||||
WBDOannot00000776 | ||||||||
WBDOannot00000785 | ||||||||
Reference | WBPaper00046077 | |||||||
WBPaper00055989 | ||||||||
Remark | 2726/2727-3044/3045 (318 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |