WormBase Tree Display for Variation: WBVar00252950

WBVar00252950 Name: Public_name: tm4519
    Other_name: CE16165:p.Ala70CysfsTer59
      H04D03.1.1:c.208_496del
    HGVSg: CHROMOSOME_III:g.10437037_10437439del
  Sequence_details: SMap: S_parent: Sequence: H04D03
    Flanking_sequences: acgaaaaatgtaaacgtgaccgctctttcc tgctgtgtcgtttgcgaattggtgtctcta
    Mapping_target: H04D03
    Source_location: 7 CHROMOSOME_III 10437036 10437440 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4519_external
      tm4519_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4519
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00010362
    Transcript: H04D03.1.1 (11)
    Interactor: WBInteraction000500381
      WBInteraction000500383
      WBInteraction000500384
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000632 Paper_evidence: WBPaper00038105
        Curator_confirmed: WBPerson712
        Remark: Animals have mild fasciculation defects. Paper_evidence: WBPaper00038105
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0004867 PATO:0000460 Paper_evidence: WBPaper00038105
                Curator_confirmed: WBPerson712
            WBbt:0004865 PATO:0000460 Paper_evidence: WBPaper00038105
                Curator_confirmed: WBPerson712
            WBbt:0004842 PATO:0000460 Paper_evidence: WBPaper00038105
                Curator_confirmed: WBPerson712
            WBbt:0004863 PATO:0000460 Paper_evidence: WBPaper00038105
                Curator_confirmed: WBPerson712
            WBbt:0004841 PATO:0000460 Paper_evidence: WBPaper00038105
                Curator_confirmed: WBPerson712
            WBbt:0004861 PATO:0000460 Paper_evidence: WBPaper00038105
                Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001224 Paper_evidence: WBPaper00038105
        Curator_confirmed: WBPerson712
        Remark: Animals exhibit mild axon migration defects such that axons had partial fasciculations or the axons crossed over each other, although the axons always reached the dorsal cord. Defects in individual axons were more severe in tm4519 than in rq1 animals. Axon migrations of the GABAergic VD and DD sets, as well as of the mechanosensory touch receptor neurons were not significantly affected compared to wild-type controls. Paper_evidence: WBPaper00038105
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0004867 PATO:0000460 Paper_evidence: WBPaper00038105
                Curator_confirmed: WBPerson712
            WBbt:0004842 PATO:0000460 Paper_evidence: WBPaper00038105
                Curator_confirmed: WBPerson712
            WBbt:0004863 PATO:0000460 Paper_evidence: WBPaper00038105
                Curator_confirmed: WBPerson712
            WBbt:0004865 PATO:0000460 Paper_evidence: WBPaper00038105
                Curator_confirmed: WBPerson712
            WBbt:0004841 PATO:0000460 Paper_evidence: WBPaper00038105
                Curator_confirmed: WBPerson712
            WBbt:0004861 PATO:0000460 Paper_evidence: WBPaper00038105
                Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000195 Paper_evidence: WBPaper00038105
        Curator_confirmed: WBPerson712
        Remark: Animals did not have any distal tip cell defects. Paper_evidence: WBPaper00038105
            Curator_confirmed: WBPerson712
  Reference: WBPaper00038105
  Remark: 7000/7001-7403/7404 (403 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele