WormBase Tree Display for Variation: WBVar00253117

WBVar00253117 Evidence: Paper_evidence: WBPaper00032907
  Name: Public_name: tr125
    Other_name: CE20549:p.Gly44Glu
      C38C3.5.1:c.131G>A
    HGVSg: CHROMOSOME_V:g.1477379G>A
  Sequence_details: SMap: S_parent: Sequence: C38C3
    Flanking_sequences: aatgacaccgccatcgtcgtcgagaaggtcg agagaagaatgctccgtacgccgagttcgtt
    Mapping_target: C38C3
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00032907
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: RP
    Status: Live
  Affects: Gene: WBGene00006794
    Transcript: C38C3.5.1 (12)
  Isolation: Mutagen: EMS
  Genetics: Interpolated_map_position: V -18.8767
  Description: Phenotype: WBPhenotype:0001930 Paper_evidence: WBPaper00032907
        Curator_confirmed: WBPerson712
        Remark: Animals were isolated based on altered or fewer muscle arms, observed by an altered pattern of trIs25 reporter expression, which expresses membrane-anchored YFP in select muscles of only the distal row of body wall muscles. Paper_evidence: WBPaper00032907
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: RP112 Paper_evidence: WBPaper00032907
              Curator_confirmed: WBPerson712
  Reference: WBPaper00032907
  Method: Substitution_allele