WormBase Tree Display for Variation: WBVar00266627
expand all nodes | collapse all nodes | view schema
WBVar00266627 | Evidence | Paper_evidence | WBPaper00005356 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | F57H12 | |||||
Flanking_sequences | gataatcttgctaaactctcagctcattgc | ttcagcttcgtactcctttgacaacttgtg | |||||||
Mapping_target | F57H12 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00005356 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035038 | ||||||||
Laboratory | TU | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003178 | |||||||
Transcript | F57H12.7a.1 (12) | ||||||||
Genetics | Interpolated_map_position | IV | 3.57035 | ||||||
Mapping_data | In_multi_point | 1114 | |||||||
1115 | |||||||||
1116 | |||||||||
1117 | |||||||||
2067 | |||||||||
2068 | |||||||||
In_pos_neg_data | 2727 | ||||||||
Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00001125 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are touch sensitive as newly hatched larva but become insensitive as they mature. | Paper_evidence | WBPaper00001125 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001125 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000456 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | larvae touch sensitive, older animals touch insensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00041152 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | ALM and PLM axons in late larvae and young adults were often curved and had apparently swollen regions (Figure 2A; Figure S2A) and infrequent ectopic branches that appeared to derive from the swollen regions (Figure S2A). mec-17(u265) produced an increase in the length of the TRN processes (Figure 2B; Figure S2B). The most dramatic increase was seen in the length of a normally short, or nonexistent, ALM posterior process (Figure 2B). Both the anterior processes of the ALM neurons and the anterior and the posterior processes of the PLM neurons were longer in the mec-17 mutant strains (Figure 2B; Figure S2B) | Paper_evidence | WBPaper00041152 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00041152 | ||||
Curator_confirmed | WBPerson9270 | ||||||||
WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00041152 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00041152 | |||||
Curator_confirmed | WBPerson9270 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00041152 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00041152 | |||||
Curator_confirmed | WBPerson9270 | ||||||||
WBPhenotype:0001278 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mec-3:lacZ expression not maintained in touch cells | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005237 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002364 | Paper_evidence | WBPaper00044649 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | Spontaneous axon degeneration in adult animals, predominantly affecting PLM, but also ALM and AVM to a lessor degree (Data not shown) | Paper_evidence | WBPaper00044649 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||
Curator_confirmed | WBPerson9270 | ||||||||
WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00044649 | |||||
Curator_confirmed | WBPerson9270 | ||||||||
Reference | WBPaper00041152 | ||||||||
WBPaper00005356 | |||||||||
WBPaper00001125 | |||||||||
WBPaper00017610 | |||||||||
WBPaper00010978 | |||||||||
WBPaper00044649 | |||||||||
Remark | In addition to the lesion curated, u265 also causes a D72G (gat-ggt) mutation with flanks of attcaactttatatctctcttggaaatatg & tgagtaagttaatattcttattcatatact | Paper_evidence | WBPaper00005356 | ||||||
Method | Substitution_allele |