WormBase Tree Display for Variation: WBVar00274929
expand all nodes | collapse all nodes | view schema
WBVar00274929 | Name | Public_name | ut7 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE26710:p.Gly494Arg | |||||||
F09B12.6.1:c.1480G>A | ||||||||
HGVSg | CHROMOSOME_X:g.15092769G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F09B12 | ||||
Flanking_sequences | cgttatttcagttgctgtatggttgctctt | gagaatacaaatttcggatggcaaaccaaa | ||||||
Mapping_target | F09B12 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022183 | |||||||
Laboratory | JC | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001468 | ||||||
Transcript | F09B12.6.1 (12) | |||||||
Interactor | WBInteraction000052053 | |||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | X | 21.8462 | |||||
Mapping_data | In_2_point | 6164 | ||||||
6165 | ||||||||
In_multi_point | 2417 | |||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson309 | ||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Recessive to the wild type allele, but dominant to the weak alleles sa201 and n2259, which show normal growth, concerning growth rate. (i. e., ut7/+ grows at a normal rate, but ut7/sa201 and ut7/n2259 grow slowly.) | Person_evidence | WBPerson309 | |||||
Curator_confirmed | WBPerson48 | |||||||
Penetrance | Incomplete | Person_evidence | WBPerson309 | |||||
Curator_confirmed | WBPerson48 | |||||||
Recessive | Person_evidence | WBPerson309 | ||||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000209 | Paper_evidence | WBPaper00002315 | ||||||
Person_evidence | WBPerson309 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
Remark | Animals exhibited very short defecation cycles. Mean cycle time was 50.4 7.8 sec at 20C and 24.5 2.8 sec at 25C. | Paper_evidence | WBPaper00002315 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Complete | Person_evidence | WBPerson309 | |||||
Curator_confirmed | WBPerson48 | |||||||
Recessive | Paper_evidence | WBPaper00002315 | ||||||
Person_evidence | WBPerson309 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Person_evidence | WBPerson309 | |||||
Curator_confirmed | WBPerson48 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002315 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20, 25 | Paper_evidence | WBPaper00002315 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001502 | Person_evidence | WBPerson309 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Resistant to 0.4mg/ml NaF. | Person_evidence | WBPerson309 | |||||
Curator_confirmed | WBPerson48 | |||||||
Penetrance | Incomplete | Person_evidence | WBPerson309 | |||||
Curator_confirmed | WBPerson48 | |||||||
Phenotype_not_observed | WBPhenotype:0000012 | Person_evidence | WBPerson309 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Synthetic Daf-c with unc-3(e151). | Person_evidence | WBPerson309 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00015186 | |||||||
WBPaper00002315 | ||||||||
WBPaper00022748 | ||||||||
Method | Substitution_allele |