WormBase Tree Display for Variation: WBVar00275094
expand all nodes | collapse all nodes | view schema
WBVar00275094 | Name | Public_name | vs106 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T14E8.3a.1:c.-63_185del | |||||||
HGVSg | CHROMOSOME_X:g.6569334_6569581del | |||||||
Sequence_details | SMap | S_parent | Sequence | T14E8 | ||||
Flanking_sequences | tttccgatacttccgtattccttctactac | cttagcagtttctgattttatggtgagtta | ||||||
Mapping_target | T14E8 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (12) | ||||||||
Laboratory | LX | |||||||
CF | ||||||||
IV | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00020506 | ||||||
Transcript | T14E8.3a.1 | VEP_consequence | start_lost,5_prime_UTR_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T14E8.3a.1:c.-63_185del | |||||||
cDNA_position | 144-391 | |||||||
CDS_position | ?-185 | |||||||
Protein_position | ?-62 | |||||||
Exon_number | 1-2/14 | |||||||
T14E8.3d.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-140 | |||||||
CDS_position | ?-140 | |||||||
Protein_position | ?-47 | |||||||
Exon_number | 1/5 | |||||||
T14E8.3c.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-157 | |||||||
CDS_position | ?-140 | |||||||
Protein_position | ?-47 | |||||||
Exon_number | 1-2/13 | |||||||
T14E8.3b.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-189 | |||||||
CDS_position | ?-185 | |||||||
Protein_position | ?-62 | |||||||
Exon_number | 1-2/14 | |||||||
Interactor | WBInteraction000518033 | |||||||
WBInteraction000518035 | ||||||||
WBInteraction000518042 | ||||||||
WBInteraction000518043 | ||||||||
WBInteraction000518551 | ||||||||
WBInteraction000521890 | ||||||||
WBInteraction000521891 | ||||||||
WBInteraction000521892 | ||||||||
WBInteraction000521893 | ||||||||
Genetics | Interpolated_map_position | X | -2.77887 | |||||
Description | Phenotype (26) | |||||||
Phenotype_not_observed | WBPhenotype:0000631 | Paper_evidence | WBPaper00039822 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Only 6.7% of dop-3 animals become paralyzed after 40 min of exposure to 10 mM DA, whereas 35% of wild type worms are paralyzed. | Paper_evidence | WBPaper00039822 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004583 | Paper_evidence | WBPaper00039822 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001006 | Paper_evidence | WBPaper00044757 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure S2C | Paper_evidence | WBPaper00044757 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001101 | Paper_evidence | WBPaper00038382 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No effects on clozapine-induced egg laying were observed. | Paper_evidence | WBPaper00038382 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003634 | Paper_evidence | WBPaper00038382 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001817 | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited enhanced-gustatory plasticity, i.e. strong avoidance to NaCl after starvation, similar to that observed for wild type. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002114 | Paper_evidence | WBPaper00038270 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Wild-type animals and dop-3 (vs106) mutants swam vigorously for more than 30 min when placed in water. | Paper_evidence | WBPaper00038270 | |||||
Curator_confirmed | WBPerson712 | |||||||
mutants were not hypersensitive to aldicarb treatment | Paper_evidence | WBPaper00038270 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypermorph_gain_of_function (2) | |||||||
Disease_info | Modifies_disease | DOID:680 | ||||||
Modifies_disease_in_annotation | WBDOannot00000765 | |||||||
WBDOannot00000766 | ||||||||
WBDOannot00000767 | ||||||||
Reference (13) | ||||||||
Remark | This deletion removes 86 bp of the promoter, the first transmembrane domain and the entire first intracellular loop and most of the second transmembrane domain. | Paper_evidence | WBPaper00024390 | |||||
Method | Deletion_allele |