WormBase Tree Display for Variation: WBVar00275117
expand all nodes | collapse all nodes | view schema
WBVar00275117 | Evidence | Paper_evidence | WBPaper00005233 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | wa4 | |||||
Other_name | CE25113:p.Gly32Ser | ||||||
T13F2.1a.1:c.94G>A | |||||||
HGVSg | CHROMOSOME_IV:g.9799564G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | T13F2 | |||
Flanking_sequences | attgacgatgctgtcctgagatcacatcca | gtggtagtgcaattactacctataaaaata | |||||
Mapping_target | T13F2 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005233 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | BX | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001396 | |||||
Transcript | T13F2.1a.1 (12) | ||||||
Genetics | Interpolated_map_position | IV | 4.41947 | ||||
Mapping_data | In_multi_point | 4300 | |||||
Description | Phenotype | WBPhenotype:0000138 | Paper_evidence | WBPaper00005233 | |||
Curator_confirmed | WBPerson2987 | ||||||
Remark | fat-4 mutants displayed a fatty acid profile with reduced 20:4n6 and 20:5n3 and increased levels of 20:3n6 and 20:4n3 that lack a double bond at the delta-5 position. The original segregating population contained 0.2% 20:4n6 and 12% 20:5n3 as compared with 1.7% 20:4n6 and 17.2% 20:5n3 in WT, and 7% 20:3n6 and 16.5.% 20:4n3 compared with 6% 20:3n6 and 9.8% 20:4n3 in WT. Analysis of progeny from the segregating population again revealed three classes: (i) WT, (ii) the original segregating fatty acid profile, and (iii) a population with no detectable 20:4n6 or 20:5n3 and 8.2% 20:3 and 24.8% 20:4n3 (Fig. 3E, Table 1). | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Phenotype_not_observed | WBPhenotype:0000520 | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Similar to the fat-1 mutants, fat-4 homozygotes are indistinguishable phenotypically from WT under laboratory conditions ( Fig . 3E ) . | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000624 | Paper_evidence | WBPaper00005233 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Similar to the fat-1 mutants, fat-4 homozygotes are indistinguishable phenotypically from WT under laboratory conditions ( Fig . 3E ) . | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00005233 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Similar to the fat-1 mutants, fat-4 homozygotes are indistinguishable phenotypically from WT under laboratory conditions ( Fig . 3E ) . | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000676 | Paper_evidence | WBPaper00005233 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Similar to the fat-1 mutants, fat-4 homozygotes are indistinguishable phenotypically from WT under laboratory conditions ( Fig . 3E ) . | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Reference | WBPaper00005233 | ||||||
Method | Substitution_allele |