WormBase Tree Display for Variation: WBVar00275119
expand all nodes | collapse all nodes | view schema
| WBVar00275119 | Evidence | Paper_evidence | WBPaper00005233 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | wa9 | |||||
| Other_name | CE22790:p.Gln156Ter | ||||||
| Y67H2A.8.1:c.466C>T | |||||||
| HGVSg | CHROMOSOME_IV:g.13316111C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | Y67H2A | |||
| Flanking_sequences | tcaccactcttctctccatacttcccatgg | agaaaagtcacaagcttcaccatgctgtta | |||||
| Mapping_target | Y67H2A | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00005233 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00004010 | ||||||
| WBStrain00004013 | |||||||
| Laboratory | BX | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001393 | |||||
| Transcript | Y67H2A.8.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | Y67H2A.8.1:c.466C>T | ||||||
| HGVSp | CE22790:p.Gln156Ter | ||||||
| cDNA_position | 468 | ||||||
| CDS_position | 466 | ||||||
| Protein_position | 156 | ||||||
| Exon_number | 2/5 | ||||||
| Codon_change | Cag/Tag | ||||||
| Amino_acid_change | Q/* | ||||||
| Genetics | Interpolated_map_position | IV | 8.52214 | ||||
| Mapping_data | In_multi_point | 4297 | |||||
| Description (2) | |||||||
| Disease_info | Models_disease | DOID:1574 | |||||
| Models_disease_in_annotation | WBDOannot00000709 | ||||||
| Reference | WBPaper00005233 | ||||||
| WBPaper00028527 | |||||||
| WBPaper00060921 | |||||||
| Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||
| Created by WBPerson1983 from the NN_VFP_triage_pipeline | |||||||
| Method | Substitution_allele |
