WormBase Tree Display for Variation: WBVar00275119
expand all nodes | collapse all nodes | view schema
WBVar00275119 | Evidence | Paper_evidence | WBPaper00005233 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | wa9 | |||||||
Other_name | CE22790:p.Gln156Ter | ||||||||
Y67H2A.8.1:c.466C>T | |||||||||
HGVSg | CHROMOSOME_IV:g.13316111C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y67H2A | |||||
Flanking_sequences | tcaccactcttctctccatacttcccatgg | agaaaagtcacaagcttcaccatgctgtta | |||||||
Mapping_target | Y67H2A | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00005233 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004010 | ||||||||
WBStrain00004013 | |||||||||
Laboratory | BX | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001393 | |||||||
Transcript | Y67H2A.8.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y67H2A.8.1:c.466C>T | ||||||||
HGVSp | CE22790:p.Gln156Ter | ||||||||
cDNA_position | 468 | ||||||||
CDS_position | 466 | ||||||||
Protein_position | 156 | ||||||||
Exon_number | 2/5 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Genetics (2) | |||||||||
Description | Phenotype | WBPhenotype:0000138 | Paper_evidence | WBPaper00005233 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutations in the fat-1 gene result in the loss of n3 polyunsaturated fatty acids (PUFAs) (Fig. 1, Table 1). The GC analysis of populations produced from mutated F1 hermaphrodites revealed three independent lines that displayed a reduction in the n3 PUFAs 20:4n3 and 20:5n3. These lines contained ~17% n3 PUFAs compared with 27% in WT controls. Concomitantly, the C20 n6 precursors (20:3n6 + 20:4n6) increased from 7.8% in WT to 13.7% in the mutant. Analysis of populations derived from single F3 generation worms revealed three segregating classes (Fig. 1): (i) a WT fatty acid composition, (ii) the originally identified reduced n3 composition, and (iii) a fatty acid profile consisting of no detectable n3 PUFAs and correspondingly increased levels of the C20 n6 fatty acids (20:3n6 + 20:4n6 = 35.5%). | Paper_evidence | WBPaper00005233 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000520 | Paper_evidence | WBPaper00005233 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Despite the elimination of n3 polyunsaturated fatty acids (PUFAs) and the dramatic increase in n6 PUFAs , all three fat-1 alleles grow at the same rate as WT with no apparent defects in morphology , movement , or reproduction , indicating that under laboratory conditions , n3 fatty acids are not essential for these processes (Fig . 3B) . | Paper_evidence | WBPaper00005233 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000624 | Paper_evidence | WBPaper00005233 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Despite the elimination of n3 polyunsaturated fatty acids (PUFAs) and the dramatic increase in n6 PUFAs , all three fat-1 alleles grow at the same rate as WT with no apparent defects in morphology , movement , or reproduction , indicating that under laboratory conditions , n3 fatty acids are not essential for these processes (Fig . 3B) . | Paper_evidence | WBPaper00005233 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00005233 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Despite the elimination of n3 polyunsaturated fatty acids (PUFAs) and the dramatic increase in n6 PUFAs , all three fat-1 alleles grow at the same rate as WT with no apparent defects in morphology , movement , or reproduction , indicating that under laboratory conditions , n3 fatty acids are not essential for these processes (Fig . 3B) . | Paper_evidence | WBPaper00005233 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000676 | Paper_evidence | WBPaper00005233 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Despite the elimination of n3 polyunsaturated fatty acids (PUFAs) and the dramatic increase in n6 PUFAs, all three fat-1 alleles grow at the same rate as WT with no apparent defects in morphology, movement, or reproduction, indicating that under laboratory conditions, n3 fatty acids are not essential for these processes (Fig. 3B). | Paper_evidence | WBPaper00005233 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001823 | Paper_evidence | WBPaper00028527 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Sperm motility defects were not observed | Paper_evidence | WBPaper00028527 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00028527 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Wild-type males labelled with MitoTracker were mated to non-labelled mutant hermaphrodites | Paper_evidence | WBPaper00028527 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Disease_info | Models_disease | DOID:1574 | |||||||
Models_disease_in_annotation | WBDOannot00000709 | ||||||||
Reference | WBPaper00005233 | ||||||||
WBPaper00028527 | |||||||||
WBPaper00060921 | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson1983 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |