WormBase Tree Display for Variation: WBVar00275142
expand all nodes | collapse all nodes | view schema
WBVar00275142 | Evidence | Paper_evidence | WBPaper00003757 | ||
---|---|---|---|---|---|
Name | Public_name | wd44 | |||
Other_name | CE01560:p.Trp20Ter | ||||
F26C11.2.1:c.59delinsA | |||||
HGVSg | CHROMOSOME_II:g.9900199delinsT | ||||
Sequence_details | SMap | S_parent | Sequence | F26C11 | |
Flanking_sequences | acgctgagccaaaaattatcaacgacattt | gcagatttctggaaatcacaaattaattca | |||
Mapping_target | F26C11 | ||||
Type_of_mutation | Substitution | gg | rr | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00028648 | ||||
Laboratory | NC | ||||
Status | Live | ||||
Affects | Gene | WBGene00006744 | |||
Transcript | F26C11.2.1 | VEP_consequence | stop_gained | ||
VEP_impact | HIGH | ||||
HGVSc | F26C11.2.1:c.59delinsA | ||||
HGVSp | CE01560:p.Trp20Ter | ||||
cDNA_position | 178-179 | ||||
CDS_position | 59-60 | ||||
Protein_position | 20 | ||||
Exon_number | 2/8 | ||||
Codon_change | tGG/tAG | ||||
Amino_acid_change | W/* | ||||
Genetics | Interpolated_map_position | II | 1.77067 | ||
Reference | WBPaper00003757 | ||||
WBPaper00061175 | |||||
Remark | wd44 comprises a nonsense mutation of W(20) to either an opal or an amber stop codon. | Paper_evidence | WBPaper00003757 | ||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006744 Amber_UAG_or_Opal_UGA W(20) to stop | Paper_evidence | WBPaper00003757 | |||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||
Method | Substitution_allele |