WormBase Tree Display for Variation: WBVar00275146
expand all nodes | collapse all nodes | view schema
WBVar00275146 | Evidence | Paper_evidence | WBPaper00044867 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | wk7 | ||||||
Other_name | C32D5.2.1:c.216T>A | |||||||
CE01842:p.Tyr72Ter | ||||||||
HGVSg | CHROMOSOME_II:g.6324751T>A | |||||||
Sequence_details | SMap | S_parent | Sequence | C32D5 | ||||
Flanking_sequences | tattttgaaaaatcgatgttattgcaatta | gatcagtcgatatgtggaaataatatgaca | ||||||
Mapping_target | C32D5 | |||||||
Type_of_mutation | Substitution | t | r | Paper_evidence | WBPaper00044867 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00026327 | |||||||
Laboratory | LT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004860 | ||||||
Transcript | C32D5.2.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | C32D5.2.1:c.216T>A | |||||||
HGVSp | CE01842:p.Tyr72Ter | |||||||
cDNA_position | 221 | |||||||
CDS_position | 216 | |||||||
Protein_position | 72 | |||||||
Exon_number | 3/14 | |||||||
Codon_change | taT/taA | |||||||
Amino_acid_change | Y/* | |||||||
Interactor | WBInteraction000500850 | |||||||
WBInteraction000500860 | ||||||||
WBInteraction000502075 | ||||||||
WBInteraction000504396 | ||||||||
WBInteraction000544073 | ||||||||
WBInteraction000555971 | ||||||||
Genetics | Interpolated_map_position | II | -0.382225 | |||||
Description | Phenotype | WBPhenotype:0000070 | Paper_evidence | WBPaper00005858 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Tale has fusions of rays 4-5,6-7,8-9. | Paper_evidence | WBPaper00005858 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000136 | Paper_evidence | WBPaper00025090 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants show an up-regulation of the lon-1 transcript | Paper_evidence | WBPaper00025090 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00025090 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants show a reduction in brood size | Paper_evidence | WBPaper00025090 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00029002 | ||||||
WBPaper00036735 | ||||||||
WBPaper00005858 | ||||||||
Curator_confirmed | WBPerson557 | |||||||
WBPerson712 | ||||||||
WBPhenotype:0000297 | Paper_evidence | WBPaper00036735 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Although structural processes were fused, neuronal processes were well separated. | Paper_evidence | WBPaper00036735 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | sma-6(wk7) animals were hypersensitive to levamisole | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00034730 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000901 | Paper_evidence | WBPaper00045065 | ||||||
Curator_confirmed | WBPerson460 | |||||||
WBPhenotype:0001183 | Paper_evidence | WBPaper00053184 | ||||||
Curator_confirmed | WBPerson12433 | |||||||
WBPhenotype:0001202 | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | sma-6(wk7) animals were hypersensitive to nicotine | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001212 | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | sma-6(wk7) mutants were sick and paralyzed immediately in drug assays, likely indicating a cuticle defect | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0000006 | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | All these animals retained a similar number of eggs when compared to wild-type animals (~10 eggs). | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Young well-fed animals were scored | Paper_evidence | WBPaper00032082 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 25 | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000019 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals did not exhibit reduced pharyngeal pumping when compared with daf-7(e1375). | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Pumping rates were assayed for well-fed , pheromone-untreated; food-deprived, pheromone-untreated; and well-fed, pheromone-treated animals. Pheromone treatment consisted of transfer of animals grown under well-fed conditions to plates containing 30 ul/ml of a dauer-pheromone prep (Golden and Riddle, 1982) and 30 ml of OP50 E. coli food. | Paper_evidence | WBPaper00032082 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 20 | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001182 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Fat levels were similar to that seen in wild-type but are reduced when compared to daf-7(e1375) as determined by Sudan Black assay (described in Kimura et al., 1997). | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | To minimize staining variability, which allowed for quantitative comparisons between various genotypes: animals from one genotype were labeled with fluorescein isothiocyanate (FITC) and then fixed and stained in the same tube as unlabeled animals from another genotype. | Paper_evidence | WBPaper00032082 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 22 | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Abnormally sized mutants did not display enhanced fat accumulation | Paper_evidence | WBPaper00032966 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Nile Red staining | Paper_evidence | WBPaper00032966 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (13) | ||||||||
Method | Substitution_allele |