WormBase Tree Display for Variation: WBVar00275344
expand all nodes | collapse all nodes | view schema
WBVar00275344 | Evidence | Paper_evidence | WBPaper00031432 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | y284 | |||||
Other_name | Y39A1B.3.1:c.3817C>T | ||||||
CE31734:p.Gln1273Ter | |||||||
HGVSg | CHROMOSOME_III:g.10772978C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | Y39A1B | |||
Flanking_sequences | gagctcaactcgagaactgataccattata | agttgctccccgagttcttgtatcatttgt | |||||
Mapping_target | Y39A1B | ||||||
Type_of_mutation | Substitution | c | t | Person_evidence | WBPerson421 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (3) | |||||||
Affects | Gene | WBGene00001087 | |||||
Transcript | Y39A1B.3.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | Y39A1B.3.1:c.3817C>T | ||||||
HGVSp | CE31734:p.Gln1273Ter | ||||||
cDNA_position | 3833 | ||||||
CDS_position | 3817 | ||||||
Protein_position | 1273 | ||||||
Exon_number | 13/18 | ||||||
Codon_change | Cag/Tag | ||||||
Amino_acid_change | Q/* | ||||||
Genetics | Interpolated_map_position | III | 5.36615 | ||||
Reference | WBPaper00031432 | ||||||
Remark | The location of y284 was sent by personal communication from B. Meyer and is a correction of data published in Tsai et al. PMID 18198337 | Curator_confirmed | WBPerson2970 | ||||
Method | Substitution_allele |