WormBase Tree Display for Variation: WBVar00275411

WBVar00275411 Evidence: Paper_evidence: WBPaper00024246
  Name: Public_name: yj10
    Other_name: CE37656:p.Trp236Ter
      CE45668:p.Trp152Ter
      CE43555:p.Trp276Ter
      M02B1.1b.1:c.707_708delinsAA
      M02B1.1c.1:c.455_456delinsAA
      M02B1.1a.1:c.827_828delinsAA
    HGVSg: CHROMOSOME_IV:g.12852613_12852614delinsAA
  Sequence_details: SMap: S_parent: Sequence: ZK896
    Flanking_sequences: gattgttgtatggttttgactcaattgttt cttactgtactttggtacggtgttggaggt
    Mapping_target: ZK896
    Type_of_mutation: Substitution: gg rr
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00000252
      WBStrain00004723
    Laboratory: AT
    Status: Live
  Affects: Gene: WBGene00303140
      WBGene00005153
    Transcript: M02B1.1b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: M02B1.1b.1:c.707_708delinsAA
        HGVSp: CE37656:p.Trp236Ter
        cDNA_position: 707-708
        CDS_position: 707-708
        Protein_position: 236
        Exon_number: 5/6
        Codon_change: tGG/tAA
        Amino_acid_change: W/*
      M02B1.1a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: M02B1.1a.1:c.827_828delinsAA
        HGVSp: CE43555:p.Trp276Ter
        cDNA_position: 839-840
        CDS_position: 827-828
        Protein_position: 276
        Exon_number: 7/9
        Codon_change: tGG/tAA
        Amino_acid_change: W/*
      M02B1.1c.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: M02B1.1c.1:c.455_456delinsAA
        HGVSp: CE45668:p.Trp152Ter
        cDNA_position: 455-456
        CDS_position: 455-456
        Protein_position: 152
        Exon_number: 3/4
        Codon_change: tGG/tAA
        Amino_acid_change: W/*
    Interactor: WBInteraction000008513
      WBInteraction000008516
      WBInteraction000052148
  Isolation: Mutagen: EMS Paper_evidence: WBPaper00001280
  Genetics: Interpolated_map_position: IV 6.37431
    Mapping_data: In_2_point: 4986
        4987
      In_multi_point: 1750
        1751
        2656
      In_pos_neg_data: 4985
        7207
  Description: Phenotype (16)
    Phenotype_not_observed: WBPhenotype:0000006 Paper_evidence: WBPaper00001576
        Curator_confirmed: WBPerson712
        Remark: Populations exhibited a slight increase in the number of bloated animals. Paper_evidence: WBPaper00001576
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00001576
          Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000057 PATO:0000460 Paper_evidence: WBPaper00001576
                Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: him-5(e1490) Paper_evidence: WBPaper00001576
              Curator_confirmed: WBPerson712
      WBPhenotype:0000031 Paper_evidence: WBPaper00037686
        Curator_confirmed: WBPerson712
        Remark: Animals did not exhibit any conspicuous difference from wild type. Paper_evidence: WBPaper00037686
            Curator_confirmed: WBPerson712
      WBPhenotype:0000072 Paper_evidence: WBPaper00001280
        Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00001280
          Curator_confirmed: WBPerson712
      WBPhenotype:0000145 Paper_evidence: WBPaper00037686
        Curator_confirmed: WBPerson712
        Remark: Animals did not exhibit any conspicuous differences from wild type. Paper_evidence: WBPaper00037686
            Curator_confirmed: WBPerson712
      WBPhenotype:0000202 Paper_evidence: WBPaper00001280
        Curator_confirmed: WBPerson712
        Remark: Alae were observed on adults as expected for wild type animals. Paper_evidence: WBPaper00001280
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00001280
          Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000041 PATO:0000460 Paper_evidence: WBPaper00001280
                Curator_confirmed: WBPerson712
      WBPhenotype:0001384 Paper_evidence: WBPaper00024246
        Curator_confirmed: WBPerson712
        Remark: Brood sizes were not significantly different between populations of mutants grown on E.coli versus grown on M. nematophilum, whereas there is a 50% decrease in brood size for N2 worms. Paper_evidence: WBPaper00024246
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were grown on plates containing 0.1% Microbacterium nematophilum CBX102. Paper_evidence: WBPaper00024246
              Curator_confirmed: WBPerson712
      WBPhenotype:0001412 Paper_evidence: WBPaper00001576
        Curator_confirmed: WBPerson712
        Remark: Adult lateral alae are normal as assayed by DIC microscopy. Paper_evidence: WBPaper00001576
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00001576
          Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000041 PATO:0000460 Paper_evidence: WBPaper00001576
                Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: him-5(e1490) Paper_evidence: WBPaper00001576
              Curator_confirmed: WBPerson712
      WBPhenotype:0001415 Paper_evidence: WBPaper00026735
        Curator_confirmed: WBPerson48
        Remark: Based on vital dye staining for bacteria to reveal M. nematophilum; very little rectal staining, indicating poor adherence in the usual region, but some general surface staining not seen in wild type Paper_evidence: WBPaper00026735
            Curator_confirmed: WBPerson48
      WBPhenotype:0001629 Paper_evidence: WBPaper00001576
        Curator_confirmed: WBPerson712
        Remark: Animals increase egg-laying to a similar, if not greater, extent as N2 in response to exgenous serotonin. Paper_evidence: WBPaper00001576
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00001576
          Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000057 PATO:0000460 Paper_evidence: WBPaper00001576
                Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: him-5(e1490) Paper_evidence: WBPaper00001576
              Curator_confirmed: WBPerson712
  Reference (11)
  Remark: yj10 is either a W(236) -> amber or a W(236) -> opal nonsense mutation. Paper_evidence: WBPaper00024246
    Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00005153 Amber_UAG_or_Opal_UGA W(236) to stop Paper_evidence: WBPaper00024246
    Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00303140
  Method: Substitution_allele