WormBase Tree Display for Variation: WBVar00296488
expand all nodes | collapse all nodes | view schema
WBVar00296488 | Evidence | Paper_evidence | WBPaper00001404 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | sy7 | |||||
Other_name | CE50411:p.Gly1086Glu | ||||||
ZK1067.1c.1:c.3236G>A | |||||||
CE42891:p.Gly1013Glu | |||||||
CE42910:p.Gly1079Glu | |||||||
CE03840:p.Gly1074Glu | |||||||
ZK1067.1b.1:c.3038G>A | |||||||
ZK1067.1a.1:c.3221G>A | |||||||
ZK1067.1d.1:c.3257G>A | |||||||
HGVSg | CHROMOSOME_II:g.9205763G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | ZK1067 | |||
Flanking_sequences | acacccatgcttctgatgtttgggcatttg | agtcacatgttgggagattataacatttgg | |||||
Mapping_target | ZK1067 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001404 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | PS | ||||||
Status | Live | ||||||
Affects (2) | |||||||
Genetics | Interpolated_map_position | II | 1.09463 | ||||
Description | Phenotype | WBPhenotype:0000062 | Paper_evidence | WBPaper00001404 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Identified in a noncomplementation screen with let-23(sy1) scoring for the Vulvaless phenotype. | Paper_evidence | WBPaper00001404 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00001404 | |||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00001404 | ||||||
Method | Substitution_allele |