WormBase Tree Display for Variation: WBVar00296669
expand all nodes | collapse all nodes | view schema
WBVar00296669 | Evidence | Paper_evidence | WBPaper00037652 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n4132 | |||||
Other_name | F33H1.1e.1:c.81-998_81-533del | ||||||
F33H1.1d.1:c.150-998_150-533del | |||||||
F33H1.1b.1:c.582-998_582-533del | |||||||
F33H1.1a.1:c.507-998_507-533del | |||||||
HGVSg | CHROMOSOME_II:g.10161576_10162041del | ||||||
Sequence_details | SMap | S_parent | Sequence | F33H1 | |||
Flanking_sequences | gtaacagcagccatcacaagccacaagcta | gccaccgccgagccagtgagctcacagttg | |||||
Mapping_target | F33H1 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | MT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00000914 | |||||
Transcript | F33H1.1c.1 | VEP_consequence | 5_prime_UTR_variant | ||||
VEP_impact | MODIFIER | ||||||
cDNA_position | ?-98 | ||||||
Exon_number | 1/9 | ||||||
F33H1.1a.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | ||||||
HGVSc | F33H1.1a.1:c.507-998_507-533del | ||||||
Intron_number | 5/12 | ||||||
F33H1.1b.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | ||||||
HGVSc | F33H1.1b.1:c.582-998_582-533del | ||||||
Intron_number | 6/13 | ||||||
F33H1.1e.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | ||||||
HGVSc | F33H1.1e.1:c.81-998_81-533del | ||||||
Intron_number | 1/7 | ||||||
F33H1.1d.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | ||||||
HGVSc | F33H1.1d.1:c.150-998_150-533del | ||||||
Intron_number | 3/10 | ||||||
Interactor | WBInteraction000052369 | ||||||
WBInteraction000052370 | |||||||
WBInteraction000504824 | |||||||
WBInteraction000504825 | |||||||
WBInteraction000504826 | |||||||
WBInteraction000541776 | |||||||
Genetics | Interpolated_map_position | II | 2.1418 | ||||
Description | Phenotype | WBPhenotype:0000306 | Paper_evidence | WBPaper00037652 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals exhibit a loss of Ppkd-2::GFP expression in male-specific CEM head neurons. | n4132 mutant males do not express lov-1, pkd-2, or klp-6 GFP reporters in the male-specific CEMs,HOB, and RnB neurons. | n4132 also disrupts KLP-6::GFP expression in the core IL2 neurons of males and hermaphrodites from embryogenesis through adulthood. | n4132 abolishes CWP-1::GFP expression in IL2 and PKD neurons. | n4132 specifically disrupts Pnlp-8::GFP in HOB without affecting expression in core neurons. | In n4132 animals, osm-9 expression is disrupted only in the IL2 and PKD neurons. | n4132 does not affect ciliogenic gene expression of intraflagellar transport (IFT) componentOSM-6:;GFP in PKD, core IL2, or other ciliated sensory neurons. | n4132 does not affect ciliogenic gene expression of other IFT reporters including osm-5, bbs-1, bbs-2, bbs-5, and daf-10 in PKD, core IL2, and other ciliated sensory neurons. | The odorant receptor odr-10 and guanylate cyclase (gcy-5 and gcy-32) genes that are expressed in the core nervous system are not affected by the n4132 mutation. | Paper_evidence | WBPaper00037652 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000649 | Paper_evidence | WBPaper00037652 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | n4132 males exhibit response and Lov defects. | Paper_evidence | WBPaper00037652 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00037652 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0004004 | Paper_evidence | WBPaper00037652 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | n4132 males exhibit response and Lov defects. | Paper_evidence | WBPaper00037652 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed | WBPhenotype:0000012 | Paper_evidence | WBPaper00037652 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00037652 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | In n4132 animals, IL2, amphid, and phasmid cilia are intact, as judged by fluorescent dye uptake (200/200 animals normal in dye filling assays) and visualization of an OSM-6::GFP reporter in amphid, phasmid, and male-specific sensory cilia. | Paper_evidence | WBPaper00037652 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00037652 | ||||||
Method | Deletion_allele |