WormBase Tree Display for Variation: WBVar00317430
expand all nodes | collapse all nodes | view schema
WBVar00317430 | Name | Public_name | tm5039 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C38D4.1a.1:c.409-49_547-21del | |||||||
HGVSg | CHROMOSOME_III:g.4784321_4784648del | |||||||
Sequence_details | SMap | S_parent | Sequence | C38D4 | ||||
Flanking_sequences | ctaccacatactgaaatttaaaactgcgtt | ttcgcttttcattaaatataacttaaatca | ||||||
Mapping_target | C38D4 | |||||||
Source_location | 7 | CHROMOSOME_III | 4784320 | 4784649 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm5039_external | |||||||
tm5039_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 5039 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00008003 | ||||||
Transcript | C38D4.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C38D4.1a.1:c.409-49_547-21del | |||||||
Intron_number | 3-4/7 | |||||||
Exon_number | 4/8 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 1984/1985-2312/2313 (328 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |